Starting /dee2/code/volunteer_pipeline.sh SRR3207945 current disk space = 3053081137152 free memory = 1579164648 SRR3207945 SRAfilesize 7d69e2d64f43236c564d3eae3dc460ba SRR3207945.sra SRR3207945.sra file validated SRR3207945 is single end SRR3207945 is conventional basespace SRR3207945 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207945_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14525 34.0 33.0 34.0 31.0 34.0 2 33.26225 34.0 34.0 34.0 31.0 34.0 3 33.32375 34.0 34.0 34.0 31.0 34.0 4 36.56725 37.0 37.0 37.0 35.0 37.0 5 36.49825 37.0 37.0 37.0 35.0 37.0 6 36.50325 37.0 37.0 37.0 35.0 37.0 7 36.489 37.0 37.0 37.0 35.0 37.0 8 36.47525 37.0 37.0 37.0 35.0 37.0 9 38.423 39.0 39.0 39.0 37.0 39.0 10-11 38.410875000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.325625 39.0 39.0 39.0 37.0 39.0 14-15 40.005250000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.954 41.0 40.0 41.0 38.0 41.0 18-19 39.9045 41.0 40.0 41.0 38.0 41.0 20-21 39.9495 41.0 40.0 41.0 38.0 41.0 22-23 39.861125 41.0 40.0 41.0 38.0 41.0 24-25 39.735375 41.0 40.0 41.0 38.0 41.0 26-27 39.715 41.0 40.0 41.0 37.5 41.0 28-29 39.444125 41.0 40.0 41.0 37.0 41.0 30-31 39.436375 41.0 40.0 41.0 37.0 41.0 32-33 39.16 41.0 39.5 41.0 36.0 41.0 34-35 39.28775 41.0 39.0 41.0 36.5 41.0 36-37 39.260374999999996 41.0 39.0 41.0 36.5 41.0 38-39 39.313125 41.0 39.5 41.0 36.5 41.0 40-41 39.116 40.5 39.0 41.0 36.0 41.0 42-43 39.095 40.5 39.0 41.0 36.0 41.0 44-45 39.143125 41.0 39.0 41.0 36.0 41.0 46-47 38.9405 41.0 39.0 41.0 35.0 41.0 48-49 38.946124999999995 40.0 39.0 41.0 35.0 41.0 50-51 39.117374999999996 41.0 39.0 41.0 36.0 41.0 52-53 39.135875 41.0 39.0 41.0 36.0 41.0 54-55 38.929500000000004 41.0 39.0 41.0 35.0 41.0 56-57 38.860125 41.0 39.0 41.0 35.0 41.0 58-59 38.632999999999996 40.5 38.5 41.0 35.0 41.0 60-61 38.1495 40.0 37.5 41.0 34.0 41.0 62-63 37.973625 40.0 37.0 41.0 34.0 41.0 64-65 37.786875 39.0 36.5 41.0 34.0 41.0 66-67 37.357625 39.0 36.0 41.0 34.0 41.0 68-69 37.017125 38.5 35.5 40.5 34.0 41.0 70-71 36.542625 37.0 35.0 39.5 33.0 41.0 72-73 35.980875 37.0 35.0 39.0 33.0 41.0 74-75 35.458375000000004 36.5 35.0 39.0 32.5 40.5 76-77 34.65175 35.5 34.5 37.0 31.0 39.0 78-79 34.62125 35.5 35.0 37.0 32.0 39.0 80-81 34.384125 35.0 35.0 37.0 32.0 38.5 82-83 34.15075 35.0 35.0 36.0 32.0 37.0 84-85 33.878125 35.0 35.0 36.0 31.5 37.0 86-87 33.68925 35.0 35.0 35.5 31.5 36.5 88-89 33.552375 35.0 34.5 35.0 31.0 36.0 90-91 33.361875 35.0 34.0 35.0 31.0 36.0 92-93 33.082499999999996 35.0 34.0 35.0 31.0 36.0 94-95 32.948625 35.0 34.0 35.0 31.0 36.0 96-97 32.942125000000004 35.0 34.0 35.0 31.0 35.0 98-99 32.6995 35.0 34.0 35.0 30.0 35.0 100 32.35075 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 4.0 11 1.0 12 2.0 13 2.0 14 4.0 15 4.0 16 3.0 17 7.0 18 4.0 19 4.0 20 6.0 21 6.0 22 3.0 23 8.0 24 12.0 25 10.0 26 16.0 27 22.0 28 37.0 29 20.0 30 25.0 31 52.0 32 53.0 33 62.0 34 95.0 35 143.0 36 285.0 37 778.0 38 1783.0 39 548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.6 16.150000000000002 14.6 42.65 2 20.0 24.675 35.975 19.35 3 21.25 27.150000000000002 28.050000000000004 23.549999999999997 4 24.125 32.800000000000004 20.8 22.275 5 24.725 35.35 21.975 17.95 6 20.7 36.925000000000004 23.775 18.6 7 15.725 20.3 42.575 21.4 8 17.925 24.65 30.349999999999998 27.075 9 21.5 23.0 31.0 24.5 10-11 23.4375 33.287499999999994 22.45 20.825 12-13 20.349999999999998 26.575 28.962500000000002 24.1125 14-15 20.95 28.012500000000003 28.012500000000003 23.025000000000002 16-17 22.400000000000002 28.249999999999996 27.6 21.75 18-19 21.3875 28.975 27.037499999999998 22.6 20-21 22.3 28.375 27.0875 22.237499999999997 22-23 21.65 30.099999999999998 27.0875 21.1625 24-25 20.7941876487536 27.546035325065766 28.498058374044845 23.16171865213579 26-27 21.725 28.512500000000003 27.1375 22.625 28-29 21.619250532648202 29.97869407193884 26.53214688557463 21.869908509838325 30-31 21.50564617314931 29.18444165621079 26.96361355081556 22.346298619824342 32-33 21.2 28.625 27.0125 23.1625 34-35 20.3875 28.599999999999998 28.65 22.3625 36-37 22.9625 27.55 27.35 22.1375 38-39 21.5 29.3875 25.9625 23.150000000000002 40-41 22.475 29.2875 27.375 20.8625 42-43 21.25 28.3375 28.237499999999997 22.175 44-45 21.125 27.737499999999997 27.400000000000002 23.7375 46-47 22.3375 27.8375 27.212500000000002 22.6125 48-49 21.337500000000002 28.1875 27.762500000000003 22.7125 50-51 22.3 27.8125 28.0875 21.8 52-53 21.875 28.775000000000002 26.887499999999996 22.4625 54-55 21.8125 28.037499999999998 27.675 22.475 56-57 21.8 28.287499999999998 27.625 22.287499999999998 58-59 21.675 28.5875 27.8125 21.925 60-61 22.787499999999998 27.975 27.325 21.912499999999998 62-63 21.975 28.825 27.200000000000003 22.0 64-65 22.1875 28.525 27.537499999999998 21.75 66-67 22.225 29.5 26.950000000000003 21.325 68-69 21.224999999999998 29.312500000000004 27.737499999999997 21.725 70-71 21.675 29.562500000000004 27.237499999999997 21.525 72-73 21.5 28.749999999999996 28.1375 21.6125 74-75 22.037499999999998 29.1125 27.0 21.85 76-77 22.8625 28.575 27.237499999999997 21.325 78-79 21.587500000000002 28.262500000000003 28.037499999999998 22.112499999999997 80-81 22.725 28.275 28.075 20.925 82-83 21.475 28.787499999999998 27.925 21.8125 84-85 21.525 28.075 27.0125 23.3875 86-87 21.775 27.9375 28.4375 21.85 88-89 21.5 28.4125 27.6 22.4875 90-91 20.6625 28.349999999999998 28.5625 22.425 92-93 21.912499999999998 27.650000000000002 27.85 22.5875 94-95 22.4625 28.675 27.712500000000002 21.15 96-97 22.1 28.299999999999997 26.8625 22.7375 98-99 21.8625 28.875 27.474999999999998 21.7875 100 22.0 28.4 27.325 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.5 25 2.0 26 2.5 27 3.5 28 4.5 29 9.5 30 15.5 31 23.0 32 30.5 33 45.5 34 66.0 35 75.5 36 91.5 37 118.0 38 139.5 39 167.5 40 194.5 41 212.0 42 235.0 43 263.0 44 271.5 45 280.5 46 290.0 47 260.0 48 224.5 49 186.0 50 152.5 51 138.5 52 117.0 53 85.0 54 65.0 55 58.0 56 43.0 57 25.5 58 20.0 59 18.5 60 11.5 61 8.5 62 11.5 63 8.0 64 3.0 65 4.0 66 4.0 67 2.5 68 2.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.21250000000000002 26-27 0.0 28-29 0.2625 30-31 0.375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72137791286727 98.425 2 0.25329280648429586 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 1.075 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 43 1.075 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.0625 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.1375 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907522 spots for SRR3207945.sra Written 907522 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra Read 907517 spots for SRR3207945.sra Written 907517 spots for SRR3207945.sra SRR ids: ['SRR3207945.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g9415nyc SRR3207945.sra spots: 18150345 blocks: [[1, 907517], [907518, 1815034], [1815035, 2722551], [2722552, 3630068], [3630069, 4537585], [4537586, 5445102], [5445103, 6352619], [6352620, 7260136], [7260137, 8167653], [8167654, 9075170], [9075171, 9982687], [9982688, 10890204], [10890205, 11797721], [11797722, 12705238], [12705239, 13612755], [13612756, 14520272], [14520273, 15427789], [15427790, 16335306], [16335307, 17242823], [17242824, 18150345]] SRR3207945 file size 4712713 SRR3207945 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207945 SRR3207945_1.fastq Input file: SRR3207945_1.fastq trimmed: SRR3207945-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:21:02 2025 >> started Tue Feb 11 20:21:15 2025 >> done (12.596s) 18150345 reads processed; of these: 4277 ( 0.02%) short reads filtered out after trimming by size control 217118 ( 1.20%) empty reads filtered out after trimming by size control 17928950 (98.78%) reads available; of these: 767374 ( 4.28%) trimmed reads available after processing 17161576 (95.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 516 0.00% 19 591 0.00% 20 683 0.00% 21 800 0.00% 22 1012 0.01% 23 1309 0.01% 24 1735 0.01% 25 2309 0.01% 26 2811 0.02% 27 2621 0.01% 28 2385 0.01% 29 2418 0.01% 30 2426 0.01% 31 2435 0.01% 32 2977 0.02% 33 2744 0.02% 34 2879 0.02% 35 2758 0.02% 36 2864 0.02% 37 3109 0.02% 38 3083 0.02% 39 3148 0.02% 40 3522 0.02% 41 3403 0.02% 42 3575 0.02% 43 3636 0.02% 44 3743 0.02% 45 3835 0.02% 46 3770 0.02% 47 4036 0.02% 48 3969 0.02% 49 4071 0.02% 50 4165 0.02% 51 4315 0.02% 52 4568 0.03% 53 4831 0.03% 54 4805 0.03% 55 5277 0.03% 56 5272 0.03% 57 5371 0.03% 58 5567 0.03% 59 5789 0.03% 60 5909 0.03% 61 5950 0.03% 62 6276 0.04% 63 6212 0.03% 64 7217 0.04% 65 11517 0.06% 66 7156 0.04% 67 7083 0.04% 68 7322 0.04% 69 7475 0.04% 70 8687 0.05% 71 11348 0.06% 72 10064 0.06% 73 8868 0.05% 74 8801 0.05% 75 8487 0.05% 76 6064 0.03% 77 6701 0.04% 78 7653 0.04% 79 8216 0.05% 80 8953 0.05% 81 9426 0.05% 82 9835 0.05% 83 10912 0.06% 84 11248 0.06% 85 12148 0.07% 86 12900 0.07% 87 13839 0.08% 88 14894 0.08% 89 16301 0.09% 90 17794 0.10% 91 19636 0.11% 92 22437 0.13% 93 25268 0.14% 94 29784 0.17% 95 34259 0.19% 96 40614 0.23% 97 47858 0.27% 98 54465 0.30% 99 62664 0.35% 100 17161576 95.72% 17928950 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=9.59 fanout-score-rank=13 prefix-density=0.07 prefix-fanout=9.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=221.57 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=24.9 sequence=CTTCTTCTTCTT Started job on | Feb 11 20:21:34 Started mapping on | Feb 11 20:21:34 Finished on | Feb 11 20:21:57 Mapping speed, Million of reads per hour | 2806.27 Number of input reads | 17928950 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17002025 Uniquely mapped reads % | 94.83% Average mapped length | 98.98 Number of splices: Total | 5051397 Number of splices: Annotated (sjdb) | 4962107 Number of splices: GT/AG | 4975589 Number of splices: GC/AG | 62404 Number of splices: AT/AC | 5340 Number of splices: Non-canonical | 8064 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393003 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 77707 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533922 533922 533922 N_multimapping 393003 393003 393003 N_noFeature 676924 8756816 8806366 N_ambiguous 172645 28245 28860 UnstrandedReadsAssigned:16152456 PositiveStrandReadsAssigned:8216964 NegativeStrandReadsAssigned:8166799 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207945 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207945-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,928,950 reads, 16,559,250 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR3207945.ke.tsv 34699 SRR3207945.se.tsv 87100 total ==> SRR3207945.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 442 20.6223 Potri.005G024800.1.v4.1 1035 936 69.0072 6.60099 Potri.004G059700.1.v4.1 961 862 31 3.21992 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 272.334 8.57361 Potri.016G087400.1.v4.1 270 171 721 377.511 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 55 2.9417 Potri.012G127500.1.v4.1 977 878 2256 230.057 ==> SRR3207945.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1449 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207945 completed mapping pipeline successfully