Starting /dee2/code/volunteer_pipeline.sh SRR3207946 current disk space = 3053522046976 free memory = 1510936980 SRR3207946 SRAfilesize e6e322da5e5c28ec0e941c6697567ad3 SRR3207946.sra SRR3207946.sra file validated SRR3207946 is single end SRR3207946 is conventional basespace SRR3207946 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207946_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07825 34.0 33.0 34.0 31.0 34.0 2 33.27975 34.0 34.0 34.0 31.0 34.0 3 33.37025 34.0 34.0 34.0 31.0 34.0 4 36.60175 37.0 37.0 37.0 35.0 37.0 5 36.478 37.0 37.0 37.0 35.0 37.0 6 36.4965 37.0 37.0 37.0 35.0 37.0 7 36.49375 37.0 37.0 37.0 35.0 37.0 8 36.4665 37.0 37.0 37.0 35.0 37.0 9 38.391 39.0 39.0 39.0 37.0 39.0 10-11 38.35275 39.0 39.0 39.0 37.0 39.0 12-13 38.27375 39.0 39.0 39.0 37.0 39.0 14-15 39.92675 41.0 40.0 41.0 38.0 41.0 16-17 39.961875 41.0 40.0 41.0 38.0 41.0 18-19 39.943375 41.0 40.0 41.0 38.0 41.0 20-21 39.990875 41.0 40.0 41.0 38.0 41.0 22-23 39.902875 41.0 40.0 41.0 38.0 41.0 24-25 39.845625 41.0 40.0 41.0 38.0 41.0 26-27 39.746125 41.0 40.0 41.0 38.0 41.0 28-29 39.561875 41.0 40.0 41.0 37.5 41.0 30-31 39.6065 41.0 40.0 41.0 37.5 41.0 32-33 39.203374999999994 41.0 39.5 41.0 36.0 41.0 34-35 39.26575 41.0 39.0 41.0 36.0 41.0 36-37 39.291125 41.0 39.5 41.0 36.0 41.0 38-39 39.28875 41.0 39.0 41.0 36.5 41.0 40-41 39.19475 41.0 39.0 41.0 36.0 41.0 42-43 39.139625 40.5 39.0 41.0 36.0 41.0 44-45 39.206374999999994 41.0 39.0 41.0 36.0 41.0 46-47 38.886875 41.0 39.0 41.0 35.0 41.0 48-49 39.01525 41.0 39.0 41.0 35.0 41.0 50-51 39.14475 41.0 39.0 41.0 36.0 41.0 52-53 39.15625 41.0 39.0 41.0 35.0 41.0 54-55 38.983 41.0 39.0 41.0 35.0 41.0 56-57 38.879625000000004 41.0 39.0 41.0 35.0 41.0 58-59 38.789874999999995 41.0 38.5 41.0 35.0 41.0 60-61 38.37975 40.0 38.0 41.0 35.0 41.0 62-63 38.23425 40.0 37.0 41.0 34.0 41.0 64-65 38.010875 39.5 37.0 41.0 34.0 41.0 66-67 37.680499999999995 39.0 36.0 41.0 34.0 41.0 68-69 37.21275 39.0 35.5 41.0 34.0 41.0 70-71 36.76925 37.5 35.0 40.0 33.5 41.0 72-73 36.32575 37.0 35.0 39.0 33.0 41.0 74-75 35.805625 36.5 35.0 39.0 33.0 40.5 76-77 34.9855 36.0 34.5 37.0 31.5 39.0 78-79 35.01325 36.0 35.0 37.0 32.0 39.0 80-81 34.783125 35.0 35.0 37.0 32.0 39.0 82-83 34.461125 35.0 35.0 36.0 32.0 37.0 84-85 34.285624999999996 35.0 35.0 36.0 32.5 37.0 86-87 34.045375 35.0 35.0 36.0 32.0 36.5 88-89 33.880750000000006 35.0 35.0 35.0 32.0 36.0 90-91 33.661874999999995 35.0 34.5 35.0 31.5 36.0 92-93 33.413375 35.0 34.0 35.0 31.5 36.0 94-95 33.2455 35.0 34.0 35.0 31.0 36.0 96-97 33.195499999999996 35.0 34.0 35.0 31.0 35.5 98-99 32.942750000000004 35.0 34.0 35.0 30.5 35.0 100 32.73975 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 3.0 12 2.0 13 0.0 14 2.0 15 2.0 16 4.0 17 3.0 18 2.0 19 3.0 20 4.0 21 10.0 22 3.0 23 4.0 24 10.0 25 7.0 26 12.0 27 20.0 28 24.0 29 23.0 30 34.0 31 35.0 32 47.0 33 72.0 34 95.0 35 155.0 36 285.0 37 737.0 38 1842.0 39 554.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.025 16.6 12.9 45.475 2 19.3 22.95 38.025 19.725 3 21.775 26.025 27.375 24.825 4 23.425 32.775 21.15 22.650000000000002 5 23.08654327163582 34.54227113556778 23.036518259129565 19.334667333666832 6 18.8 36.375 25.1 19.725 7 17.075000000000003 18.7 43.6 20.625 8 18.775 24.525 29.825000000000003 26.875 9 20.724999999999998 23.825 31.45 24.0 10-11 22.3 33.050000000000004 23.3125 21.337500000000002 12-13 20.6125 27.462500000000002 29.262500000000003 22.662499999999998 14-15 20.150000000000002 28.1625 29.175 22.5125 16-17 22.0625 28.287499999999998 28.3875 21.2625 18-19 21.462500000000002 27.8375 28.1375 22.5625 20-21 23.0625 27.8875 26.75 22.3 22-23 21.0375 28.675 28.175 22.112499999999997 24-25 21.275797373358348 28.2801751094434 28.655409631019385 21.788617886178862 26-27 21.1625 28.849999999999998 27.737499999999997 22.25 28-29 21.63142749906168 29.500813211560118 27.073689478293506 21.7940698110847 30-31 21.6270337922403 28.297872340425535 28.235294117647058 21.83979974968711 32-33 21.575 27.987499999999997 27.987499999999997 22.45 34-35 21.8 27.975 28.1625 22.0625 36-37 20.962500000000002 27.875 28.712500000000002 22.45 38-39 21.637500000000003 28.6125 27.85 21.9 40-41 22.1 28.6375 27.675 21.587500000000002 42-43 21.0125 28.375 28.712500000000002 21.9 44-45 22.625 27.700000000000003 28.012500000000003 21.6625 46-47 21.3 28.725 27.750000000000004 22.225 48-49 21.1875 29.15 27.85 21.8125 50-51 22.1 29.349999999999998 26.525 22.025 52-53 21.2875 29.062500000000004 27.8375 21.8125 54-55 21.825 28.1875 27.6 22.3875 56-57 22.05 28.9 27.8625 21.1875 58-59 21.5 28.037499999999998 28.237499999999997 22.225 60-61 22.125 27.5875 28.0875 22.2 62-63 21.45 28.925 27.762500000000003 21.8625 64-65 21.525 28.549999999999997 27.650000000000002 22.275 66-67 21.6125 27.8125 28.3625 22.2125 68-69 21.637500000000003 27.725 28.8625 21.775 70-71 22.112499999999997 28.325 27.650000000000002 21.912499999999998 72-73 21.825 28.875 26.787499999999998 22.5125 74-75 21.675 29.225 27.5125 21.587500000000002 76-77 22.412499999999998 28.125 27.700000000000003 21.762500000000003 78-79 21.9375 28.525 27.925 21.6125 80-81 22.0625 28.1 28.050000000000004 21.7875 82-83 22.1 27.712500000000002 28.012500000000003 22.175 84-85 23.05 27.700000000000003 27.700000000000003 21.55 86-87 22.025 28.712500000000002 28.050000000000004 21.212500000000002 88-89 21.9625 28.249999999999996 27.85 21.9375 90-91 22.0875 28.6375 27.750000000000004 21.525 92-93 22.175 28.3375 28.037499999999998 21.45 94-95 22.075 27.5875 27.975 22.3625 96-97 21.725 28.775000000000002 28.1625 21.337500000000002 98-99 22.0125 28.037499999999998 28.799999999999997 21.15 100 21.9 27.650000000000002 28.475 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 5.5 26 5.0 27 6.0 28 9.5 29 9.5 30 17.5 31 31.0 32 31.5 33 46.5 34 64.0 35 73.5 36 91.0 37 125.0 38 155.0 39 167.5 40 202.5 41 232.5 42 250.0 43 268.5 44 272.5 45 273.5 46 263.0 47 243.0 48 214.5 49 181.5 50 161.0 51 124.5 52 98.5 53 91.0 54 68.5 55 47.0 56 35.5 57 24.0 58 22.5 59 22.0 60 15.0 61 11.5 62 11.0 63 8.0 64 5.0 65 3.0 66 1.0 67 1.0 68 1.5 69 2.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0625 26-27 0.0 28-29 0.08750000000000001 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608747 spots for SRR3207946.sra Written 608747 spots for SRR3207946.sra Read 608759 spots for SRR3207946.sra Written 608759 spots for SRR3207946.sra SRR ids: ['SRR3207946.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wkbaipo9 SRR3207946.sra spots: 12174952 blocks: [[1, 608747], [608748, 1217494], [1217495, 1826241], [1826242, 2434988], [2434989, 3043735], [3043736, 3652482], [3652483, 4261229], [4261230, 4869976], [4869977, 5478723], [5478724, 6087470], [6087471, 6696217], [6696218, 7304964], [7304965, 7913711], [7913712, 8522458], [8522459, 9131205], [9131206, 9739952], [9739953, 10348699], [10348700, 10957446], [10957447, 11566193], [11566194, 12174952]] SRR3207946 file size 3157640 SRR3207946 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207946 SRR3207946_1.fastq Input file: SRR3207946_1.fastq trimmed: SRR3207946-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:26:13 2025 >> started Tue Feb 11 19:26:20 2025 >> done (6.511s) 12174952 reads processed; of these: 1645 ( 0.01%) short reads filtered out after trimming by size control 12323 ( 0.10%) empty reads filtered out after trimming by size control 12160984 (99.89%) reads available; of these: 515119 ( 4.24%) trimmed reads available after processing 11645865 (95.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 256 0.00% 19 311 0.00% 20 346 0.00% 21 455 0.00% 22 597 0.00% 23 840 0.01% 24 1213 0.01% 25 1467 0.01% 26 1995 0.02% 27 2053 0.02% 28 1713 0.01% 29 1735 0.01% 30 1707 0.01% 31 1616 0.01% 32 1811 0.01% 33 1751 0.01% 34 1853 0.02% 35 1892 0.02% 36 1959 0.02% 37 2001 0.02% 38 2057 0.02% 39 2117 0.02% 40 2203 0.02% 41 2307 0.02% 42 2421 0.02% 43 2371 0.02% 44 2427 0.02% 45 2552 0.02% 46 2630 0.02% 47 2672 0.02% 48 2639 0.02% 49 2840 0.02% 50 2731 0.02% 51 2896 0.02% 52 3030 0.02% 53 3205 0.03% 54 3296 0.03% 55 3433 0.03% 56 3446 0.03% 57 3662 0.03% 58 3718 0.03% 59 3725 0.03% 60 3822 0.03% 61 3945 0.03% 62 4064 0.03% 63 4050 0.03% 64 4060 0.03% 65 4389 0.04% 66 4433 0.04% 67 4616 0.04% 68 4954 0.04% 69 4949 0.04% 70 5038 0.04% 71 5235 0.04% 72 5524 0.05% 73 5643 0.05% 74 5993 0.05% 75 5807 0.05% 76 4222 0.03% 77 4742 0.04% 78 5443 0.04% 79 5763 0.05% 80 6214 0.05% 81 6578 0.05% 82 7011 0.06% 83 7581 0.06% 84 7838 0.06% 85 8397 0.07% 86 8926 0.07% 87 9814 0.08% 88 10312 0.08% 89 11258 0.09% 90 12395 0.10% 91 13766 0.11% 92 15387 0.13% 93 17469 0.14% 94 20538 0.17% 95 23415 0.19% 96 28317 0.23% 97 32826 0.27% 98 37104 0.31% 99 43332 0.36% 100 11645865 95.76% 12160984 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=10.45 fanout-score-rank=15 prefix-density=0.07 prefix-fanout=10.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=7 fanout-score=185.63 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=24.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 19:26:44 Started mapping on | Feb 11 19:26:44 Finished on | Feb 11 19:27:05 Mapping speed, Million of reads per hour | 2084.74 Number of input reads | 12160984 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11244773 Uniquely mapped reads % | 92.47% Average mapped length | 98.98 Number of splices: Total | 3215686 Number of splices: Annotated (sjdb) | 3152592 Number of splices: GT/AG | 3166583 Number of splices: GC/AG | 40311 Number of splices: AT/AC | 3671 Number of splices: Non-canonical | 5121 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258707 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 82934 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.72% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 657504 657504 657504 N_multimapping 258707 258707 258707 N_noFeature 527980 5818908 5870218 N_ambiguous 122858 19597 19793 UnstrandedReadsAssigned:10593935 PositiveStrandReadsAssigned:5406268 NegativeStrandReadsAssigned:5354762 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207946 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207946-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,160,984 reads, 10,884,622 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR3207946.ke.tsv 34699 SRR3207946.se.tsv 87100 total ==> SRR3207946.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 487 34.718 Potri.005G024800.1.v4.1 1035 936 76 11.1081 Potri.004G059700.1.v4.1 961 862 48 7.61789 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 158.322 7.61574 Potri.016G087400.1.v4.1 270 171 384 307.211 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 26 2.1248 Potri.012G127500.1.v4.1 977 878 769 119.821 ==> SRR3207946.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1404 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207946 completed mapping pipeline successfully