Starting /dee2/code/volunteer_pipeline.sh SRR3207947 current disk space = 3053510144000 free memory = 1502884176 SRR3207947 SRAfilesize d278e21dc9c5916bd353e663f4eda1b2 SRR3207947.sra SRR3207947.sra file validated SRR3207947 is single end SRR3207947 is conventional basespace SRR3207947 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207947_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.114 34.0 33.0 34.0 31.0 34.0 2 33.25825 34.0 34.0 34.0 31.0 34.0 3 33.2875 34.0 34.0 34.0 31.0 34.0 4 36.56 37.0 37.0 37.0 35.0 37.0 5 36.48075 37.0 37.0 37.0 35.0 37.0 6 36.48725 37.0 37.0 37.0 35.0 37.0 7 36.48 37.0 37.0 37.0 35.0 37.0 8 36.45175 37.0 37.0 37.0 35.0 37.0 9 38.36975 39.0 39.0 39.0 37.0 39.0 10-11 38.353125 39.0 39.0 39.0 37.0 39.0 12-13 38.293625000000006 39.0 39.0 39.0 37.0 39.0 14-15 39.932 41.0 40.0 41.0 38.0 41.0 16-17 39.87175 41.0 40.0 41.0 38.0 41.0 18-19 39.857124999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.942125000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.818375 41.0 40.0 41.0 38.0 41.0 24-25 39.753375 41.0 40.0 41.0 38.0 41.0 26-27 39.65025 41.0 40.0 41.0 38.0 41.0 28-29 39.45 41.0 40.0 41.0 37.0 41.0 30-31 39.508250000000004 41.0 40.0 41.0 37.0 41.0 32-33 39.226 41.0 39.5 41.0 36.5 41.0 34-35 39.248374999999996 41.0 39.0 41.0 36.0 41.0 36-37 39.2675 41.0 39.0 41.0 36.0 41.0 38-39 39.24125 41.0 39.0 41.0 36.0 41.0 40-41 39.063 40.5 39.0 41.0 35.5 41.0 42-43 39.02775 40.5 39.0 41.0 35.5 41.0 44-45 39.07225 41.0 39.0 41.0 35.5 41.0 46-47 38.894000000000005 40.5 39.0 41.0 35.0 41.0 48-49 38.88075 40.0 39.0 41.0 35.0 41.0 50-51 39.041624999999996 41.0 39.0 41.0 35.5 41.0 52-53 39.07825 41.0 39.0 41.0 35.5 41.0 54-55 38.929625 41.0 39.0 41.0 35.0 41.0 56-57 38.7725 41.0 39.0 41.0 35.0 41.0 58-59 38.58275 40.5 38.0 41.0 35.0 41.0 60-61 38.168 40.0 37.0 41.0 34.0 41.0 62-63 38.080625 40.0 37.0 41.0 34.0 41.0 64-65 37.841375 39.0 36.5 41.0 34.0 41.0 66-67 37.539874999999995 39.0 36.0 41.0 34.0 41.0 68-69 37.005250000000004 38.5 35.5 40.5 34.0 41.0 70-71 36.59525 37.0 35.0 40.0 33.0 41.0 72-73 36.241 37.0 35.0 39.0 33.0 41.0 74-75 35.69975 36.5 35.0 39.0 32.5 40.5 76-77 34.838 35.5 34.5 37.0 31.5 39.0 78-79 34.885125 35.5 35.0 37.0 32.0 39.0 80-81 34.6075 35.0 35.0 37.0 32.0 39.0 82-83 34.35 35.0 35.0 36.0 32.0 37.0 84-85 34.140375 35.0 35.0 36.0 32.0 37.0 86-87 33.886875 35.0 35.0 36.0 32.0 37.0 88-89 33.671875 35.0 35.0 35.0 31.5 36.0 90-91 33.49725 35.0 34.0 35.0 31.5 36.0 92-93 33.309375 35.0 34.0 35.0 31.0 36.0 94-95 33.143375 35.0 34.0 35.0 31.0 36.0 96-97 33.068749999999994 35.0 34.0 35.0 31.0 35.5 98-99 32.882000000000005 35.0 34.0 35.0 30.5 35.0 100 32.72325 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 7.0 12 3.0 13 3.0 14 5.0 15 2.0 16 3.0 17 2.0 18 1.0 19 8.0 20 2.0 21 2.0 22 6.0 23 6.0 24 3.0 25 11.0 26 18.0 27 23.0 28 26.0 29 26.0 30 27.0 31 40.0 32 61.0 33 62.0 34 84.0 35 150.0 36 297.0 37 766.0 38 1788.0 39 561.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.624999999999996 15.55 13.025 45.800000000000004 2 19.55 24.55 37.475 18.425 3 20.9 27.150000000000002 27.950000000000003 24.0 4 24.125 31.874999999999996 21.349999999999998 22.650000000000002 5 24.525 34.875 23.775 16.825000000000003 6 18.975 36.925000000000004 24.05 20.05 7 16.975 18.925 43.2 20.9 8 18.8 23.525 31.125000000000004 26.55 9 20.9 21.45 33.125 24.525 10-11 22.287499999999998 32.9 23.35 21.462500000000002 12-13 21.425 26.737499999999997 28.712500000000002 23.125 14-15 21.0375 28.1125 28.3375 22.5125 16-17 22.787499999999998 28.425 26.987499999999997 21.8 18-19 20.9375 28.725 27.275 23.0625 20-21 22.1875 27.8625 27.650000000000002 22.3 22-23 21.099999999999998 29.362500000000004 27.437499999999996 22.1 24-25 21.851156973108193 28.61788617886179 27.754846779237024 21.776110068792995 26-27 21.775 28.299999999999997 27.1125 22.8125 28-29 22.24724724724725 27.740240240240237 28.115615615615614 21.896896896896898 30-31 21.614518147684606 27.972465581977474 27.94743429286608 22.465581977471842 32-33 22.2625 28.462500000000002 27.675 21.6 34-35 22.275 27.325 28.7 21.7 36-37 22.125 27.8625 27.150000000000002 22.8625 38-39 21.1375 29.1875 28.225 21.45 40-41 22.537499999999998 27.675 27.775 22.0125 42-43 21.1125 28.1875 28.849999999999998 21.85 44-45 21.875 28.225 28.499999999999996 21.4 46-47 21.825 27.6125 28.275 22.287499999999998 48-49 22.1 27.175 28.462500000000002 22.2625 50-51 21.712500000000002 28.037499999999998 27.8125 22.4375 52-53 22.162499999999998 28.375 27.725 21.7375 54-55 21.8875 27.8875 28.0625 22.162499999999998 56-57 22.3 27.400000000000002 28.262500000000003 22.037499999999998 58-59 22.05 27.650000000000002 28.1125 22.1875 60-61 21.3 28.6125 27.975 22.112499999999997 62-63 22.662499999999998 28.15 27.775 21.4125 64-65 21.575 28.575 27.825 22.025 66-67 21.375 28.299999999999997 28.375 21.95 68-69 22.237499999999997 28.499999999999996 27.075 22.1875 70-71 21.6875 28.6125 28.275 21.425 72-73 22.3 28.537499999999998 27.5875 21.575 74-75 22.0 27.425 28.525 22.05 76-77 21.337500000000002 27.825 27.8125 23.025000000000002 78-79 21.275 28.825 27.775 22.125 80-81 22.6375 27.3875 28.749999999999996 21.224999999999998 82-83 21.85 28.025 28.499999999999996 21.625 84-85 22.3 27.537499999999998 27.787499999999998 22.375 86-87 22.25 28.999999999999996 27.537499999999998 21.212500000000002 88-89 22.975 28.299999999999997 27.075 21.65 90-91 22.0625 27.9375 27.800000000000004 22.2 92-93 22.3875 27.762500000000003 28.4125 21.4375 94-95 22.675 28.125 27.725 21.475 96-97 22.3125 28.525 27.9125 21.25 98-99 21.975 29.462500000000002 27.0125 21.55 100 21.925 29.25 26.674999999999997 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.0 25 3.0 26 8.0 27 10.0 28 12.0 29 17.0 30 19.5 31 24.0 32 30.5 33 42.5 34 53.5 35 75.0 36 96.5 37 116.0 38 148.0 39 164.5 40 177.5 41 199.5 42 254.5 43 284.0 44 269.5 45 262.5 46 254.5 47 238.0 48 217.5 49 191.0 50 158.0 51 137.0 52 108.5 53 85.5 54 70.5 55 52.5 56 41.0 57 33.5 58 28.5 59 22.0 60 18.5 61 16.5 62 10.0 63 8.5 64 9.0 65 6.5 66 4.0 67 1.5 68 0.5 69 0.5 70 0.5 71 2.0 72 1.5 73 0.0 74 0.0 75 1.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0625 26-27 0.0 28-29 0.1 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74861739567622 99.2 2 0.22624434389140274 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.07500000000000001 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.1375 0.0 0.0 0.0 0.0 50-51 0.16249999999999998 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732696 spots for SRR3207947.sra Written 732696 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra Read 732680 spots for SRR3207947.sra Written 732680 spots for SRR3207947.sra SRR ids: ['SRR3207947.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ha154c6q SRR3207947.sra spots: 14653616 blocks: [[1, 732680], [732681, 1465360], [1465361, 2198040], [2198041, 2930720], [2930721, 3663400], [3663401, 4396080], [4396081, 5128760], [5128761, 5861440], [5861441, 6594120], [6594121, 7326800], [7326801, 8059480], [8059481, 8792160], [8792161, 9524840], [9524841, 10257520], [10257521, 10990200], [10990201, 11722880], [11722881, 12455560], [12455561, 13188240], [13188241, 13920920], [13920921, 14653616]] SRR3207947 file size 3802697 SRR3207947 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207947 SRR3207947_1.fastq Input file: SRR3207947_1.fastq trimmed: SRR3207947-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:16:42 2025 >> started Tue Feb 11 19:16:50 2025 >> done (7.290s) 14653616 reads processed; of these: 3213 ( 0.02%) short reads filtered out after trimming by size control 58610 ( 0.40%) empty reads filtered out after trimming by size control 14591793 (99.58%) reads available; of these: 638216 ( 4.37%) trimmed reads available after processing 13953577 (95.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 375 0.00% 19 528 0.00% 20 5420 0.04% 21 731 0.01% 22 824 0.01% 23 1234 0.01% 24 1628 0.01% 25 2055 0.01% 26 2778 0.02% 27 2430 0.02% 28 2188 0.01% 29 2427 0.02% 30 2061 0.01% 31 2266 0.02% 32 2280 0.02% 33 2154 0.01% 34 2356 0.02% 35 2325 0.02% 36 2408 0.02% 37 2619 0.02% 38 2652 0.02% 39 2705 0.02% 40 2775 0.02% 41 2865 0.02% 42 3057 0.02% 43 2961 0.02% 44 3054 0.02% 45 3270 0.02% 46 3327 0.02% 47 3327 0.02% 48 3496 0.02% 49 3517 0.02% 50 3455 0.02% 51 3608 0.02% 52 3749 0.03% 53 3887 0.03% 54 4046 0.03% 55 4218 0.03% 56 4321 0.03% 57 4463 0.03% 58 4661 0.03% 59 4639 0.03% 60 4754 0.03% 61 5010 0.03% 62 5302 0.04% 63 6660 0.05% 64 5421 0.04% 65 5605 0.04% 66 5750 0.04% 67 5938 0.04% 68 6043 0.04% 69 6251 0.04% 70 6221 0.04% 71 6297 0.04% 72 6655 0.05% 73 6946 0.05% 74 6972 0.05% 75 6858 0.05% 76 5084 0.03% 77 5671 0.04% 78 6481 0.04% 79 6733 0.05% 80 7301 0.05% 81 7847 0.05% 82 8323 0.06% 83 9160 0.06% 84 9671 0.07% 85 10048 0.07% 86 10890 0.07% 87 11917 0.08% 88 12798 0.09% 89 15017 0.10% 90 16763 0.11% 91 16575 0.11% 92 18393 0.13% 93 21078 0.14% 94 24506 0.17% 95 28350 0.19% 96 33294 0.23% 97 39759 0.27% 98 44336 0.30% 99 52398 0.36% 100 13953577 95.63% 14591793 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=12.25 fanout-score-rank=11 prefix-density=0.08 prefix-fanout=12.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAGAAGAGCACAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=196.62 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=24.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 19:17:09 Started mapping on | Feb 11 19:17:09 Finished on | Feb 11 19:17:32 Mapping speed, Million of reads per hour | 2283.93 Number of input reads | 14591793 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13354624 Uniquely mapped reads % | 91.52% Average mapped length | 98.97 Number of splices: Total | 3915184 Number of splices: Annotated (sjdb) | 3845759 Number of splices: GT/AG | 3857617 Number of splices: GC/AG | 47506 Number of splices: AT/AC | 3991 Number of splices: Non-canonical | 6070 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314148 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 61198 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.90% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 923021 923021 923021 N_multimapping 314148 314148 314148 N_noFeature 530223 6866486 6926926 N_ambiguous 135912 22106 22535 UnstrandedReadsAssigned:12688489 PositiveStrandReadsAssigned:6466032 NegativeStrandReadsAssigned:6405163 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207947 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207947-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,591,793 reads, 13,004,499 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR3207947.ke.tsv 34699 SRR3207947.se.tsv 87100 total ==> SRR3207947.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 454 26.5266 Potri.005G024800.1.v4.1 1035 936 85 10.1823 Potri.004G059700.1.v4.1 961 862 18 2.34135 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 212.084 8.36143 Potri.016G087400.1.v4.1 270 171 534 350.144 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 2.47826 Potri.012G127500.1.v4.1 977 878 1463 186.832 ==> SRR3207947.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1552 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207947 completed mapping pipeline successfully