Starting /dee2/code/volunteer_pipeline.sh SRR3207948 current disk space = 3053402611712 free memory = 1464881668 SRR3207948 SRAfilesize 495a6e869356de509c2fab7d90a5fdc2 SRR3207948.sra SRR3207948.sra file validated SRR3207948 is single end SRR3207948 is conventional basespace SRR3207948 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207948_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18075 34.0 33.0 34.0 31.0 34.0 2 33.34825 34.0 34.0 34.0 31.0 34.0 3 33.37575 34.0 34.0 34.0 31.0 34.0 4 36.6465 37.0 37.0 37.0 35.0 37.0 5 36.499 37.0 37.0 37.0 35.0 37.0 6 36.504 37.0 37.0 37.0 35.0 37.0 7 36.53025 37.0 37.0 37.0 35.0 37.0 8 36.5005 37.0 37.0 37.0 35.0 37.0 9 38.4265 39.0 39.0 39.0 37.0 39.0 10-11 38.431375 39.0 39.0 39.0 37.0 39.0 12-13 38.336875 39.0 39.0 39.0 37.0 39.0 14-15 40.056 41.0 40.0 41.0 38.0 41.0 16-17 39.987 41.0 40.0 41.0 38.0 41.0 18-19 39.945875 41.0 40.0 41.0 38.0 41.0 20-21 40.017375 41.0 40.0 41.0 38.0 41.0 22-23 39.9025 41.0 40.0 41.0 38.0 41.0 24-25 39.826875 41.0 40.0 41.0 38.0 41.0 26-27 39.712375 41.0 40.0 41.0 37.5 41.0 28-29 39.567875 41.0 40.0 41.0 37.5 41.0 30-31 39.629625000000004 41.0 40.0 41.0 38.0 41.0 32-33 39.33125 41.0 39.5 41.0 36.5 41.0 34-35 39.385999999999996 41.0 39.0 41.0 37.0 41.0 36-37 39.4105 41.0 40.0 41.0 37.0 41.0 38-39 39.331875 41.0 39.5 41.0 36.5 41.0 40-41 39.176375 41.0 39.0 41.0 36.0 41.0 42-43 39.219375 41.0 39.0 41.0 36.0 41.0 44-45 39.204750000000004 41.0 39.0 41.0 36.0 41.0 46-47 38.971125 41.0 39.0 41.0 35.5 41.0 48-49 38.918625 41.0 39.0 41.0 35.0 41.0 50-51 39.08125 41.0 39.0 41.0 35.5 41.0 52-53 39.154125 41.0 39.0 41.0 36.0 41.0 54-55 39.054500000000004 41.0 39.0 41.0 35.0 41.0 56-57 39.001625000000004 41.0 39.0 41.0 35.0 41.0 58-59 38.7725 41.0 38.5 41.0 35.0 41.0 60-61 38.39125 40.0 38.0 41.0 35.0 41.0 62-63 38.251374999999996 40.0 37.0 41.0 35.0 41.0 64-65 38.0295 39.5 37.0 41.0 34.0 41.0 66-67 37.721000000000004 39.0 36.5 41.0 34.0 41.0 68-69 37.217875 39.0 36.0 41.0 34.0 41.0 70-71 36.86125 37.5 35.0 40.0 34.0 41.0 72-73 36.47725 37.0 35.0 39.0 33.0 41.0 74-75 35.92525 36.5 35.0 39.0 33.0 41.0 76-77 35.114999999999995 36.0 34.5 37.5 31.5 39.0 78-79 35.141375 36.0 35.0 37.0 32.5 39.0 80-81 34.94675 35.0 35.0 37.0 33.0 39.0 82-83 34.603875 35.0 35.0 36.5 33.0 37.0 84-85 34.358 35.0 35.0 36.0 32.5 37.0 86-87 34.11775 35.0 35.0 36.0 32.0 37.0 88-89 33.913875000000004 35.0 35.0 35.0 32.0 36.0 90-91 33.736875 35.0 35.0 35.0 32.0 36.0 92-93 33.455 35.0 34.0 35.0 31.0 36.0 94-95 33.375249999999994 35.0 34.0 35.0 31.0 36.0 96-97 33.279125 35.0 34.0 35.0 31.0 36.0 98-99 33.046125 35.0 34.0 35.0 30.5 35.0 100 32.88325 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 1.0 13 4.0 14 4.0 15 4.0 16 3.0 17 1.0 18 3.0 19 5.0 20 4.0 21 2.0 22 4.0 23 6.0 24 8.0 25 7.0 26 7.0 27 20.0 28 20.0 29 15.0 30 29.0 31 34.0 32 45.0 33 68.0 34 101.0 35 144.0 36 282.0 37 745.0 38 1791.0 39 634.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.3 16.3 12.65 48.75 2 18.5 24.75 39.525 17.224999999999998 3 20.925 27.3 27.1 24.675 4 23.674999999999997 33.35 20.599999999999998 22.375 5 22.842131598699027 36.40230172629472 22.66700025018764 18.088566424818612 6 18.15 38.35 24.8 18.7 7 17.025000000000002 19.125 43.824999999999996 20.025000000000002 8 18.5 23.9 30.55 27.05 9 19.05 23.925 32.35 24.675 10-11 22.3 33.9125 22.925 20.8625 12-13 20.5375 25.924999999999997 30.062499999999996 23.474999999999998 14-15 20.9375 27.6625 28.4375 22.9625 16-17 22.7625 28.037499999999998 26.9125 22.287499999999998 18-19 21.925 28.799999999999997 27.037499999999998 22.237499999999997 20-21 22.85 28.212500000000002 27.037499999999998 21.9 22-23 21.099999999999998 28.1375 28.225 22.537499999999998 24-25 21.31598699024268 28.57142857142857 28.05854390793095 22.0540405303978 26-27 21.4125 28.975 27.525 22.0875 28-29 21.7940698110847 28.56249218065808 28.26222945076942 21.381208557487803 30-31 20.82082082082082 28.253253253253252 27.902902902902905 23.023023023023022 32-33 21.45 29.037499999999998 26.687499999999996 22.825 34-35 21.9625 27.6625 28.287499999999998 22.0875 36-37 21.762500000000003 28.575 26.8625 22.8 38-39 22.787499999999998 28.175 27.375 21.6625 40-41 22.037499999999998 28.3625 27.375 22.225 42-43 21.5625 28.925 27.0875 22.425 44-45 21.712500000000002 28.212500000000002 28.249999999999996 21.825 46-47 22.412499999999998 28.462500000000002 27.525 21.6 48-49 22.25 28.0625 26.900000000000002 22.787499999999998 50-51 21.25 28.849999999999998 27.3375 22.5625 52-53 21.575 28.6625 27.6625 22.1 54-55 21.837500000000002 27.987499999999997 28.4 21.775 56-57 21.55 28.237499999999997 28.4125 21.8 58-59 21.725 29.212500000000002 27.3 21.762500000000003 60-61 20.8625 27.6375 28.6125 22.8875 62-63 21.4375 27.474999999999998 28.075 23.0125 64-65 21.712500000000002 28.3125 28.025 21.95 66-67 21.637500000000003 27.750000000000004 29.099999999999998 21.512500000000003 68-69 21.8125 27.975 28.212500000000002 22.0 70-71 21.512500000000003 29.375 26.974999999999998 22.1375 72-73 21.15 28.599999999999998 27.8125 22.4375 74-75 21.4875 28.6625 27.800000000000004 22.05 76-77 21.212500000000002 29.225 27.5125 22.05 78-79 21.425 28.8375 28.15 21.587500000000002 80-81 21.3625 28.3625 27.925 22.35 82-83 21.3 27.800000000000004 28.512500000000003 22.3875 84-85 21.1625 28.9125 28.012500000000003 21.912499999999998 86-87 22.775000000000002 28.237499999999997 27.675 21.3125 88-89 22.0 28.549999999999997 28.1 21.349999999999998 90-91 22.3875 28.0625 27.8375 21.712500000000002 92-93 22.175 27.487499999999997 28.7375 21.6 94-95 21.3125 28.1875 28.8625 21.637500000000003 96-97 21.725 27.487499999999997 28.325 22.4625 98-99 21.3 29.325000000000003 27.6875 21.6875 100 21.675 28.199999999999996 27.325 22.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 4.5 27 8.5 28 11.5 29 15.0 30 27.5 31 29.5 32 32.0 33 47.5 34 61.5 35 78.5 36 97.5 37 122.0 38 152.0 39 164.0 40 190.5 41 223.5 42 244.0 43 267.0 44 272.5 45 276.5 46 260.5 47 240.0 48 212.5 49 188.5 50 160.5 51 121.0 52 102.5 53 87.5 54 63.5 55 43.0 56 38.0 57 29.0 58 25.5 59 20.5 60 14.5 61 11.0 62 6.0 63 6.0 64 6.5 65 5.0 66 3.0 67 3.5 68 4.5 69 3.5 70 3.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 1.5 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.075 26-27 0.0 28-29 0.08750000000000001 30-31 0.1 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630650 spots for SRR3207948.sra Written 630650 spots for SRR3207948.sra Read 630651 spots for SRR3207948.sra Written 630651 spots for SRR3207948.sra SRR ids: ['SRR3207948.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2u9d58bx SRR3207948.sra spots: 12613001 blocks: [[1, 630650], [630651, 1261300], [1261301, 1891950], [1891951, 2522600], [2522601, 3153250], [3153251, 3783900], [3783901, 4414550], [4414551, 5045200], [5045201, 5675850], [5675851, 6306500], [6306501, 6937150], [6937151, 7567800], [7567801, 8198450], [8198451, 8829100], [8829101, 9459750], [9459751, 10090400], [10090401, 10721050], [10721051, 11351700], [11351701, 11982350], [11982351, 12613001]] SRR3207948 file size 3271638 SRR3207948 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207948 SRR3207948_1.fastq Input file: SRR3207948_1.fastq trimmed: SRR3207948-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:30:22 2025 >> started Tue Feb 11 19:30:28 2025 >> done (5.793s) 12613001 reads processed; of these: 2022 ( 0.02%) short reads filtered out after trimming by size control 37654 ( 0.30%) empty reads filtered out after trimming by size control 12573325 (99.69%) reads available; of these: 526714 ( 4.19%) trimmed reads available after processing 12046611 (95.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 259 0.00% 19 307 0.00% 20 425 0.00% 21 505 0.00% 22 642 0.01% 23 875 0.01% 24 1206 0.01% 25 1541 0.01% 26 2092 0.02% 27 2138 0.02% 28 1837 0.01% 29 1758 0.01% 30 1809 0.01% 31 1705 0.01% 32 1844 0.01% 33 1763 0.01% 34 1845 0.01% 35 1947 0.02% 36 2016 0.02% 37 2047 0.02% 38 2087 0.02% 39 2202 0.02% 40 2216 0.02% 41 2338 0.02% 42 2385 0.02% 43 2503 0.02% 44 2581 0.02% 45 2595 0.02% 46 2789 0.02% 47 2780 0.02% 48 2750 0.02% 49 2904 0.02% 50 2824 0.02% 51 2992 0.02% 52 3072 0.02% 53 3191 0.03% 54 3241 0.03% 55 3417 0.03% 56 3524 0.03% 57 3775 0.03% 58 3648 0.03% 59 3764 0.03% 60 3776 0.03% 61 3947 0.03% 62 4092 0.03% 63 4241 0.03% 64 4278 0.03% 65 4528 0.04% 66 4629 0.04% 67 4823 0.04% 68 5019 0.04% 69 5199 0.04% 70 5420 0.04% 71 5230 0.04% 72 5667 0.05% 73 5836 0.05% 74 5997 0.05% 75 6052 0.05% 76 4208 0.03% 77 4774 0.04% 78 5611 0.04% 79 5773 0.05% 80 6207 0.05% 81 6567 0.05% 82 7008 0.06% 83 7702 0.06% 84 8052 0.06% 85 8441 0.07% 86 9160 0.07% 87 9766 0.08% 88 10530 0.08% 89 11451 0.09% 90 12617 0.10% 91 13941 0.11% 92 15802 0.13% 93 17774 0.14% 94 20875 0.17% 95 24402 0.19% 96 28818 0.23% 97 33881 0.27% 98 38142 0.30% 99 44339 0.35% 100 12046611 95.81% 12573325 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=23 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=273.40 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.0 sequence=TTCTTCTTCTTC Started job on | Feb 11 19:30:43 Started mapping on | Feb 11 19:30:44 Finished on | Feb 11 19:31:02 Mapping speed, Million of reads per hour | 2514.66 Number of input reads | 12573325 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11714021 Uniquely mapped reads % | 93.17% Average mapped length | 99.00 Number of splices: Total | 3451500 Number of splices: Annotated (sjdb) | 3384636 Number of splices: GT/AG | 3397208 Number of splices: GC/AG | 45164 Number of splices: AT/AC | 3721 Number of splices: Non-canonical | 5407 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271378 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 67588 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587926 587926 587926 N_multimapping 271378 271378 271378 N_noFeature 567371 6080121 6131739 N_ambiguous 110737 20617 20767 UnstrandedReadsAssigned:11035913 PositiveStrandReadsAssigned:5613283 NegativeStrandReadsAssigned:5561515 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207948 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207948-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,573,325 reads, 11,307,767 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR3207948.ke.tsv 34699 SRR3207948.se.tsv 87100 total ==> SRR3207948.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 572 39.7822 Potri.005G024800.1.v4.1 1035 936 179 25.5238 Potri.004G059700.1.v4.1 961 862 8 1.23865 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 226.061 10.6087 Potri.016G087400.1.v4.1 270 171 319 248.979 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23 1.83375 Potri.012G127500.1.v4.1 977 878 2382 362.089 ==> SRR3207948.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1010 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR3207948 completed mapping pipeline successfully