Starting /dee2/code/volunteer_pipeline.sh SRR3207949 current disk space = 3053526773760 free memory = 1497166036 SRR3207949 SRAfilesize 28b39152c14fe57f7067e335dd144f5a SRR3207949.sra SRR3207949.sra file validated SRR3207949 is single end SRR3207949 is conventional basespace SRR3207949 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207949_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14275 34.0 33.0 34.0 31.0 34.0 2 33.269 34.0 34.0 34.0 31.0 34.0 3 33.343 34.0 34.0 34.0 31.0 34.0 4 36.4385 37.0 37.0 37.0 35.0 37.0 5 36.4635 37.0 37.0 37.0 35.0 37.0 6 36.52525 37.0 37.0 37.0 35.0 37.0 7 36.40825 37.0 37.0 37.0 35.0 37.0 8 36.5095 37.0 37.0 37.0 35.0 37.0 9 38.3615 39.0 39.0 39.0 37.0 39.0 10-11 38.356875 39.0 39.0 39.0 37.0 39.0 12-13 38.387125 39.0 39.0 39.0 37.0 39.0 14-15 40.014375 41.0 40.0 41.0 38.0 41.0 16-17 40.033 41.0 40.0 41.0 38.0 41.0 18-19 39.987875 41.0 40.0 41.0 38.0 41.0 20-21 39.958124999999995 41.0 40.0 41.0 38.0 41.0 22-23 39.896125 41.0 40.0 41.0 38.0 41.0 24-25 39.823499999999996 41.0 40.0 41.0 38.0 41.0 26-27 39.762625 41.0 40.0 41.0 38.0 41.0 28-29 39.609875 41.0 40.0 41.0 37.5 41.0 30-31 39.33325000000001 41.0 40.0 41.0 37.0 41.0 32-33 39.455625 41.0 40.0 41.0 37.0 41.0 34-35 39.423 41.0 39.5 41.0 37.0 41.0 36-37 39.361125 41.0 39.0 41.0 37.0 41.0 38-39 39.291875000000005 41.0 39.0 41.0 36.5 41.0 40-41 39.097625 40.0 39.0 41.0 35.5 41.0 42-43 39.033500000000004 40.5 39.0 41.0 35.0 41.0 44-45 38.87025 40.5 39.0 41.0 35.0 41.0 46-47 38.9405 40.0 39.0 41.0 35.0 41.0 48-49 38.91925 40.0 39.0 41.0 35.0 41.0 50-51 39.012375 41.0 39.0 41.0 35.0 41.0 52-53 39.088499999999996 41.0 39.0 41.0 35.5 41.0 54-55 39.046375 41.0 39.0 41.0 35.0 41.0 56-57 38.808 41.0 38.5 41.0 35.0 41.0 58-59 38.621875 40.0 38.0 41.0 35.0 41.0 60-61 38.39425 40.0 37.5 41.0 35.0 41.0 62-63 38.0385 40.0 37.0 41.0 34.0 41.0 64-65 37.807249999999996 39.5 36.5 41.0 34.0 41.0 66-67 37.47925 39.0 36.0 41.0 34.0 41.0 68-69 36.9465 38.5 35.5 40.5 33.0 41.0 70-71 36.67175 37.5 35.0 39.5 33.0 41.0 72-73 36.246375 37.0 35.0 39.0 33.0 41.0 74-75 35.798125 36.5 35.0 39.0 32.5 40.5 76-77 34.883625 35.5 34.0 37.0 31.0 39.0 78-79 34.991375000000005 35.5 35.0 37.0 32.0 39.0 80-81 34.633125 35.0 35.0 37.0 32.0 38.0 82-83 34.327625 35.0 35.0 36.0 31.5 37.0 84-85 34.035375 35.0 35.0 36.0 31.5 37.0 86-87 33.789625 35.0 34.5 36.0 31.0 36.5 88-89 33.53075 35.0 34.0 35.0 31.0 36.0 90-91 33.399 35.0 34.0 35.0 31.0 36.0 92-93 33.294 35.0 34.0 35.0 31.0 36.0 94-95 33.126000000000005 35.0 34.0 35.0 30.5 36.0 96-97 33.00575 35.0 34.0 35.0 31.0 35.0 98-99 32.816 35.0 34.0 35.0 30.0 35.0 100 32.61475 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 4.0 12 1.0 13 4.0 14 5.0 15 3.0 16 4.0 17 5.0 18 2.0 19 6.0 20 3.0 21 3.0 22 3.0 23 5.0 24 7.0 25 15.0 26 8.0 27 14.0 28 25.0 29 30.0 30 29.0 31 45.0 32 55.0 33 64.0 34 96.0 35 138.0 36 337.0 37 784.0 38 1801.0 39 503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.025 15.125 16.6 42.25 2 19.625 24.65 35.35 20.375 3 21.525 27.3 26.450000000000003 24.725 4 23.9 33.125 20.325 22.650000000000002 5 24.281070267566893 34.38359589897475 22.330582645661416 19.004751187796952 6 19.225 36.775000000000006 24.575 19.425 7 16.650000000000002 18.025 43.3 22.025 8 18.224999999999998 24.675 28.575 28.525 9 19.900000000000002 23.0 32.074999999999996 25.025 10-11 22.05 33.137499999999996 22.925 21.8875 12-13 19.9625 26.487500000000004 29.275000000000002 24.275 14-15 21.075 27.725 28.787499999999998 22.412499999999998 16-17 22.9625 28.125 26.937499999999996 21.975 18-19 20.6625 28.462500000000002 27.950000000000003 22.925 20-21 20.925 28.075 26.737499999999997 24.2625 22-23 21.175 28.9 27.5875 22.3375 24-25 21.354362248091125 28.97734384779071 26.912004005507573 22.75628989861059 26-27 21.837500000000002 28.812500000000004 27.224999999999998 22.125 28-29 22.85427891241699 27.57799774464353 27.628116777346197 21.939606565593284 30-31 21.211741093828397 28.110888108379328 27.91018564977421 22.76718514801806 32-33 22.3125 28.1625 27.6375 21.8875 34-35 22.225 28.3125 26.8375 22.625 36-37 21.65 27.525 28.3625 22.4625 38-39 21.4125 28.825 26.875 22.8875 40-41 22.275 27.525 27.8375 22.3625 42-43 21.95 28.525 27.250000000000004 22.275 44-45 21.7375 28.525 27.700000000000003 22.037499999999998 46-47 22.162499999999998 28.475 27.950000000000003 21.4125 48-49 22.2125 28.4375 27.150000000000002 22.2 50-51 22.3625 28.775000000000002 28.075 20.7875 52-53 20.962500000000002 28.925 28.075 22.037499999999998 54-55 21.8 27.8125 28.1125 22.275 56-57 21.45 29.1625 27.1125 22.275 58-59 22.7 27.450000000000003 27.900000000000002 21.95 60-61 22.237499999999997 27.55 27.875 22.3375 62-63 22.662499999999998 27.575 27.775 21.987499999999997 64-65 21.7875 27.8625 27.975 22.375 66-67 21.8625 28.3875 27.975 21.775 68-69 22.15 28.1375 28.1625 21.55 70-71 22.0 28.8625 27.437499999999996 21.7 72-73 22.325 28.975 26.924999999999997 21.775 74-75 21.65 28.4125 28.1625 21.775 76-77 22.025 28.012500000000003 27.8625 22.1 78-79 22.3875 27.925 28.175 21.512500000000003 80-81 21.9625 28.6375 27.425 21.975 82-83 22.0875 28.575 27.85 21.4875 84-85 22.900000000000002 28.012500000000003 27.575 21.512500000000003 86-87 22.0 28.212500000000002 28.1 21.6875 88-89 21.925 27.5875 27.762500000000003 22.725 90-91 22.5125 28.1 27.625 21.762500000000003 92-93 21.6125 28.749999999999996 27.474999999999998 22.162499999999998 94-95 22.3 27.525 27.5625 22.6125 96-97 22.025 28.237499999999997 26.75 22.9875 98-99 22.175 28.549999999999997 28.1125 21.1625 100 22.6 27.825 28.075 21.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 3.0 27 6.5 28 11.5 29 11.5 30 16.5 31 25.0 32 35.0 33 47.0 34 58.0 35 64.5 36 77.0 37 108.0 38 134.0 39 153.5 40 181.0 41 209.5 42 233.5 43 269.0 44 285.5 45 289.0 46 284.0 47 250.0 48 219.0 49 197.0 50 169.5 51 138.5 52 131.5 53 105.5 54 64.0 55 54.0 56 41.0 57 26.0 58 20.5 59 19.5 60 12.5 61 5.5 62 6.5 63 7.5 64 6.5 65 4.5 66 4.5 67 3.5 68 2.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.13749999999999998 26-27 0.0 28-29 0.2375 30-31 0.35000000000000003 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273917 spots for SRR3207949.sra Written 1273917 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra Read 1273904 spots for SRR3207949.sra Written 1273904 spots for SRR3207949.sra SRR ids: ['SRR3207949.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9xgfrl14 SRR3207949.sra spots: 25478093 blocks: [[1, 1273904], [1273905, 2547808], [2547809, 3821712], [3821713, 5095616], [5095617, 6369520], [6369521, 7643424], [7643425, 8917328], [8917329, 10191232], [10191233, 11465136], [11465137, 12739040], [12739041, 14012944], [14012945, 15286848], [15286849, 16560752], [16560753, 17834656], [17834657, 19108560], [19108561, 20382464], [20382465, 21656368], [21656369, 22930272], [22930273, 24204176], [24204177, 25478093]] SRR3207949 file size 6619696 SRR3207949 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207949 SRR3207949_1.fastq Input file: SRR3207949_1.fastq trimmed: SRR3207949-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:28:44 2025 >> started Tue Feb 11 19:28:57 2025 >> done (13.302s) 25478093 reads processed; of these: 3487 ( 0.01%) short reads filtered out after trimming by size control 48696 ( 0.19%) empty reads filtered out after trimming by size control 25425910 (99.80%) reads available; of these: 1155624 ( 4.55%) trimmed reads available after processing 24270286 (95.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 462 0.00% 19 546 0.00% 20 1091 0.00% 21 914 0.00% 22 1187 0.00% 23 1666 0.01% 24 2393 0.01% 25 3075 0.01% 26 4558 0.02% 27 3975 0.02% 28 3663 0.01% 29 3461 0.01% 30 3295 0.01% 31 3373 0.01% 32 3589 0.01% 33 3721 0.01% 34 3953 0.02% 35 4131 0.02% 36 4260 0.02% 37 4281 0.02% 38 4455 0.02% 39 4350 0.02% 40 4706 0.02% 41 4863 0.02% 42 5197 0.02% 43 5315 0.02% 44 5390 0.02% 45 5689 0.02% 46 5852 0.02% 47 5842 0.02% 48 5929 0.02% 49 6470 0.03% 50 6285 0.02% 51 6680 0.03% 52 6814 0.03% 53 7482 0.03% 54 8447 0.03% 55 7023 0.03% 56 7284 0.03% 57 7494 0.03% 58 7957 0.03% 59 7978 0.03% 60 8088 0.03% 61 8436 0.03% 62 8570 0.03% 63 9193 0.04% 64 9034 0.04% 65 9605 0.04% 66 9798 0.04% 67 10137 0.04% 68 10465 0.04% 69 10601 0.04% 70 11219 0.04% 71 11891 0.05% 72 12231 0.05% 73 12546 0.05% 74 13122 0.05% 75 13142 0.05% 76 9372 0.04% 77 10412 0.04% 78 11816 0.05% 79 13111 0.05% 80 14223 0.06% 81 14806 0.06% 82 15856 0.06% 83 16943 0.07% 84 17873 0.07% 85 18693 0.07% 86 19617 0.08% 87 21668 0.09% 88 23527 0.09% 89 26108 0.10% 90 27975 0.11% 91 31444 0.12% 92 35414 0.14% 93 40624 0.16% 94 47166 0.19% 95 54805 0.22% 96 65332 0.26% 97 77490 0.30% 98 87800 0.35% 99 90375 0.36% 100 24270286 95.45% 25425910 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.79 fanout-score-rank=17 prefix-density=0.03 prefix-fanout=5.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=278.98 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=28.2 sequence=TTCTTCTTCTTT Started job on | Feb 11 19:29:16 Started mapping on | Feb 11 19:29:16 Finished on | Feb 11 19:29:45 Mapping speed, Million of reads per hour | 3156.32 Number of input reads | 25425910 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 24158945 Uniquely mapped reads % | 95.02% Average mapped length | 98.92 Number of splices: Total | 7273407 Number of splices: Annotated (sjdb) | 7155562 Number of splices: GT/AG | 7165452 Number of splices: GC/AG | 89598 Number of splices: AT/AC | 7446 Number of splices: Non-canonical | 10911 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 570428 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 76923 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 696537 696537 696537 N_multimapping 570428 570428 570428 N_noFeature 888609 12403527 12479189 N_ambiguous 239986 37297 38155 UnstrandedReadsAssigned:23030350 PositiveStrandReadsAssigned:11718121 NegativeStrandReadsAssigned:11641601 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207949 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207949-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,425,910 reads, 23,586,565 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR3207949.ke.tsv 34699 SRR3207949.se.tsv 87100 total ==> SRR3207949.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 560 18.1653 Potri.005G024800.1.v4.1 1035 936 70 4.65533 Potri.004G059700.1.v4.1 961 862 30 2.16642 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 375.425 8.21717 Potri.016G087400.1.v4.1 270 171 933 339.636 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 51 1.89646 Potri.012G127500.1.v4.1 977 878 3172 224.889 ==> SRR3207949.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1870 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 55 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207949 completed mapping pipeline successfully