Starting /dee2/code/volunteer_pipeline.sh SRR3207950 current disk space = 3053477670912 free memory = 1054499044 SRR3207950 SRAfilesize 7024137dfae3a2a20679c87708e59824 SRR3207950.sra SRR3207950.sra file validated SRR3207950 is single end SRR3207950 is conventional basespace SRR3207950 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207950_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1115 34.0 33.0 34.0 31.0 34.0 2 33.24075 34.0 34.0 34.0 31.0 34.0 3 33.2995 34.0 34.0 34.0 31.0 34.0 4 36.35575 37.0 37.0 37.0 35.0 37.0 5 36.434 37.0 37.0 37.0 35.0 37.0 6 36.4705 37.0 37.0 37.0 35.0 37.0 7 36.437 37.0 37.0 37.0 35.0 37.0 8 36.501 37.0 37.0 37.0 35.0 37.0 9 38.373 39.0 39.0 39.0 37.0 39.0 10-11 38.341499999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.347375 39.0 39.0 39.0 37.0 39.0 14-15 39.954 41.0 40.0 41.0 38.0 41.0 16-17 39.947874999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.971125 41.0 40.0 41.0 38.0 41.0 20-21 39.835 41.0 40.0 41.0 38.0 41.0 22-23 39.817375 41.0 40.0 41.0 37.5 41.0 24-25 39.7345 41.0 40.0 41.0 37.0 41.0 26-27 39.668125 41.0 40.0 41.0 37.0 41.0 28-29 39.5745 41.0 40.0 41.0 37.5 41.0 30-31 39.30925 41.0 40.0 41.0 37.0 41.0 32-33 39.374875 41.0 40.0 41.0 37.0 41.0 34-35 39.23775 41.0 39.0 41.0 36.5 41.0 36-37 39.219375 41.0 39.0 41.0 36.5 41.0 38-39 39.215375 41.0 39.0 41.0 36.5 41.0 40-41 38.949 40.5 39.0 41.0 35.5 41.0 42-43 38.98725 40.5 39.0 41.0 35.5 41.0 44-45 38.902249999999995 40.5 39.0 41.0 35.5 41.0 46-47 38.940375 40.0 39.0 41.0 35.5 41.0 48-49 38.915125 40.0 39.0 41.0 35.0 41.0 50-51 39.07575 41.0 39.0 41.0 36.0 41.0 52-53 39.1365 41.0 39.0 41.0 36.0 41.0 54-55 39.050875000000005 41.0 39.0 41.0 35.5 41.0 56-57 38.811499999999995 41.0 39.0 41.0 35.0 41.0 58-59 38.6035 40.0 38.0 41.0 35.0 41.0 60-61 38.40925 40.0 38.0 41.0 35.0 41.0 62-63 38.041375 40.0 37.0 41.0 34.0 41.0 64-65 37.81275 39.5 37.0 41.0 34.0 41.0 66-67 37.459125 39.0 36.0 41.0 34.0 41.0 68-69 37.014250000000004 39.0 35.5 40.5 33.5 41.0 70-71 36.58325 37.5 35.0 40.0 33.0 41.0 72-73 36.179 37.0 35.0 39.0 33.0 41.0 74-75 35.721000000000004 36.5 35.0 39.0 33.0 40.5 76-77 34.729875 35.5 34.0 37.0 31.0 39.0 78-79 34.8715 35.5 35.0 37.0 32.0 39.0 80-81 34.603375 35.0 35.0 37.0 32.0 38.5 82-83 34.312875 35.0 35.0 36.0 32.0 37.0 84-85 33.99725 35.0 35.0 36.0 32.0 37.0 86-87 33.732625 35.0 35.0 36.0 31.0 36.5 88-89 33.402875 35.0 34.0 35.0 31.0 36.0 90-91 33.34775 35.0 34.0 35.0 31.0 36.0 92-93 33.272375 35.0 34.0 35.0 31.0 36.0 94-95 33.081875 35.0 34.0 35.0 31.0 36.0 96-97 32.96325 35.0 34.0 35.0 31.0 35.0 98-99 32.812124999999995 35.0 34.0 35.0 30.5 35.0 100 32.6 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 3.0 9 1.0 10 4.0 11 4.0 12 3.0 13 4.0 14 3.0 15 2.0 16 3.0 17 3.0 18 0.0 19 2.0 20 6.0 21 5.0 22 7.0 23 9.0 24 14.0 25 12.0 26 16.0 27 13.0 28 19.0 29 24.0 30 21.0 31 48.0 32 45.0 33 67.0 34 98.0 35 158.0 36 278.0 37 805.0 38 1760.0 39 558.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.974999999999998 16.05 14.774999999999999 45.2 2 18.975 24.375 37.275000000000006 19.375 3 20.849999999999998 27.450000000000003 28.15 23.549999999999997 4 24.2 32.9 20.65 22.25 5 22.455613903475868 37.23430857714429 22.005501375343837 18.30457614403601 6 17.299999999999997 38.574999999999996 24.625 19.5 7 16.775000000000002 17.05 45.4 20.775 8 19.05 23.9 29.75 27.3 9 19.725 23.0 32.824999999999996 24.45 10-11 22.8375 33.074999999999996 22.75 21.337500000000002 12-13 20.8 26.700000000000003 29.9375 22.5625 14-15 20.9875 28.050000000000004 28.1 22.8625 16-17 21.8875 28.1 27.212500000000002 22.8 18-19 21.6625 28.725 27.962500000000002 21.65 20-21 22.0125 28.749999999999996 28.012500000000003 21.224999999999998 22-23 21.55 28.4375 28.225 21.7875 24-25 21.45536384096024 28.019504876219052 28.419604901225306 22.1055263815954 26-27 21.462500000000002 28.875 27.237499999999997 22.425 28-29 21.82614133833646 28.305190744215135 27.592245153220762 22.276422764227643 30-31 22.48246492985972 28.481963927855713 26.81613226452906 22.21943887775551 32-33 21.725 29.0875 27.6875 21.5 34-35 22.375 28.449999999999996 28.449999999999996 20.724999999999998 36-37 21.65 28.999999999999996 27.725 21.625 38-39 21.3625 28.6375 28.1125 21.8875 40-41 21.099999999999998 28.549999999999997 27.5875 22.7625 42-43 21.2 28.5875 28.499999999999996 21.712500000000002 44-45 22.287499999999998 28.549999999999997 27.9125 21.25 46-47 22.3 28.237499999999997 27.9125 21.55 48-49 21.087500000000002 28.575 27.775 22.5625 50-51 22.662499999999998 27.8625 28.3625 21.1125 52-53 21.7 29.099999999999998 26.7625 22.4375 54-55 21.25 27.712500000000002 28.499999999999996 22.537499999999998 56-57 23.45 28.1125 27.0125 21.425 58-59 21.512500000000003 28.9375 27.474999999999998 22.075 60-61 21.575 28.3375 27.85 22.237499999999997 62-63 21.5375 27.8125 28.462500000000002 22.1875 64-65 23.1375 26.9625 28.6125 21.2875 66-67 22.525000000000002 28.262500000000003 27.9125 21.3 68-69 23.0625 28.3375 27.462500000000002 21.1375 70-71 22.8375 28.375 27.35 21.4375 72-73 22.3375 27.975 27.575 22.112499999999997 74-75 21.462500000000002 28.15 28.525 21.8625 76-77 22.575 27.962500000000002 27.800000000000004 21.6625 78-79 22.325 29.262500000000003 27.487499999999997 20.925 80-81 21.8125 28.037499999999998 28.075 22.075 82-83 22.7125 28.1625 27.5125 21.6125 84-85 21.725 27.525 28.125 22.625 86-87 21.625 28.349999999999998 27.825 22.2 88-89 22.4625 28.762500000000003 27.500000000000004 21.275 90-91 22.5 27.4125 28.5625 21.525 92-93 22.025 28.875 27.200000000000003 21.9 94-95 22.237499999999997 28.575 27.437499999999996 21.75 96-97 22.662499999999998 27.3125 28.625 21.4 98-99 22.1 28.449999999999996 27.6875 21.762500000000003 100 24.025 26.35 27.6 22.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.0 25 1.0 26 3.0 27 7.0 28 8.5 29 12.5 30 21.0 31 27.5 32 39.0 33 46.0 34 48.0 35 70.5 36 94.0 37 109.5 38 146.5 39 171.5 40 192.5 41 229.0 42 238.0 43 254.0 44 285.0 45 289.5 46 281.0 47 261.5 48 225.5 49 187.0 50 151.5 51 131.5 52 107.0 53 82.5 54 68.0 55 41.5 56 31.5 57 30.0 58 22.0 59 19.5 60 12.5 61 6.5 62 7.5 63 6.5 64 6.0 65 6.0 66 3.5 67 2.5 68 3.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.0625 30-31 0.2 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79949874686717 99.55000000000001 2 0.17543859649122806 0.35000000000000003 3 0.0 0.0 4 0.02506265664160401 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798353 spots for SRR3207950.sra Written 798353 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra Read 798342 spots for SRR3207950.sra Written 798342 spots for SRR3207950.sra SRR ids: ['SRR3207950.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_te1fsy9y SRR3207950.sra spots: 15966851 blocks: [[1, 798342], [798343, 1596684], [1596685, 2395026], [2395027, 3193368], [3193369, 3991710], [3991711, 4790052], [4790053, 5588394], [5588395, 6386736], [6386737, 7185078], [7185079, 7983420], [7983421, 8781762], [8781763, 9580104], [9580105, 10378446], [10378447, 11176788], [11176789, 11975130], [11975131, 12773472], [12773473, 13571814], [13571815, 14370156], [14370157, 15168498], [15168499, 15966851]] SRR3207950 file size 4144449 SRR3207950 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207950 SRR3207950_1.fastq Input file: SRR3207950_1.fastq trimmed: SRR3207950-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 19:16:37 2025 >> started Tue Feb 11 19:16:48 2025 >> done (11.698s) 15966851 reads processed; of these: 3157 ( 0.02%) short reads filtered out after trimming by size control 23651 ( 0.15%) empty reads filtered out after trimming by size control 15940043 (99.83%) reads available; of these: 727221 ( 4.56%) trimmed reads available after processing 15212822 (95.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 399 0.00% 19 427 0.00% 20 528 0.00% 21 658 0.00% 22 836 0.01% 23 1201 0.01% 24 1594 0.01% 25 2134 0.01% 26 3027 0.02% 27 2758 0.02% 28 2367 0.01% 29 2366 0.01% 30 2192 0.01% 31 2176 0.01% 32 2401 0.02% 33 2470 0.02% 34 2561 0.02% 35 2671 0.02% 36 2813 0.02% 37 2814 0.02% 38 2910 0.02% 39 2845 0.02% 40 2952 0.02% 41 3163 0.02% 42 3343 0.02% 43 3483 0.02% 44 3527 0.02% 45 3680 0.02% 46 3759 0.02% 47 3804 0.02% 48 3980 0.02% 49 4157 0.03% 50 4086 0.03% 51 4449 0.03% 52 4608 0.03% 53 5040 0.03% 54 5453 0.03% 55 4595 0.03% 56 4683 0.03% 57 4819 0.03% 58 5100 0.03% 59 5068 0.03% 60 5278 0.03% 61 5484 0.03% 62 5600 0.04% 63 5738 0.04% 64 5953 0.04% 65 6177 0.04% 66 6507 0.04% 67 6409 0.04% 68 6746 0.04% 69 6908 0.04% 70 7087 0.04% 71 7604 0.05% 72 7830 0.05% 73 8130 0.05% 74 8215 0.05% 75 8350 0.05% 76 5976 0.04% 77 6514 0.04% 78 7429 0.05% 79 8208 0.05% 80 8911 0.06% 81 9446 0.06% 82 9816 0.06% 83 10721 0.07% 84 11086 0.07% 85 11958 0.08% 86 12324 0.08% 87 13463 0.08% 88 14595 0.09% 89 15949 0.10% 90 17814 0.11% 91 19389 0.12% 92 21835 0.14% 93 24884 0.16% 94 29211 0.18% 95 34360 0.22% 96 40504 0.25% 97 47419 0.30% 98 53746 0.34% 99 55750 0.35% 100 15212822 95.44% 15940043 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=6.78 fanout-score-rank=14 prefix-density=0.04 prefix-fanout=6.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=251.45 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 19:17:08 Started mapping on | Feb 11 19:17:08 Finished on | Feb 11 19:17:26 Mapping speed, Million of reads per hour | 3188.01 Number of input reads | 15940043 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15260858 Uniquely mapped reads % | 95.74% Average mapped length | 98.89 Number of splices: Total | 4554224 Number of splices: Annotated (sjdb) | 4478660 Number of splices: GT/AG | 4486512 Number of splices: GC/AG | 56029 Number of splices: AT/AC | 4603 Number of splices: Non-canonical | 7080 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362297 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 59899 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 316888 316888 316888 N_multimapping 362297 362297 362297 N_noFeature 590414 7847943 7894514 N_ambiguous 157057 23839 24572 UnstrandedReadsAssigned:14513387 PositiveStrandReadsAssigned:7389076 NegativeStrandReadsAssigned:7341772 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207950 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207950-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,940,043 reads, 14,874,390 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR3207950.ke.tsv 34699 SRR3207950.se.tsv 87100 total ==> SRR3207950.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 344 17.5278 Potri.005G024800.1.v4.1 1035 936 47 4.90982 Potri.004G059700.1.v4.1 961 862 38 4.31042 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 234.195 8.05176 Potri.016G087400.1.v4.1 270 171 516 295.051 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 24 1.40184 Potri.012G127500.1.v4.1 977 878 1945 216.605 ==> SRR3207950.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1514 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 67 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207950 completed mapping pipeline successfully