Starting /dee2/code/volunteer_pipeline.sh SRR3207951 current disk space = 3052960325632 free memory = 1578850044 SRR3207951 SRAfilesize 27c4f3b0df11a9e686657c4c560c19ea SRR3207951.sra SRR3207951.sra file validated SRR3207951 is single end SRR3207951 is conventional basespace SRR3207951 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207951_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.184 34.0 33.0 34.0 31.0 34.0 2 33.348 34.0 34.0 34.0 31.0 34.0 3 33.38925 34.0 34.0 34.0 31.0 34.0 4 36.43925 37.0 37.0 37.0 35.0 37.0 5 36.50775 37.0 37.0 37.0 35.0 37.0 6 36.57275 37.0 37.0 37.0 35.0 37.0 7 36.51075 37.0 37.0 37.0 35.0 37.0 8 36.557 37.0 37.0 37.0 35.0 37.0 9 38.44325 39.0 39.0 39.0 37.0 39.0 10-11 38.402625 39.0 39.0 39.0 37.0 39.0 12-13 38.423125 39.0 39.0 39.0 37.0 39.0 14-15 40.077375 41.0 40.0 41.0 38.0 41.0 16-17 40.058875 41.0 40.0 41.0 38.0 41.0 18-19 40.072874999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.963875 41.0 40.0 41.0 38.0 41.0 22-23 39.88312500000001 41.0 40.0 41.0 38.0 41.0 24-25 39.852375 41.0 40.0 41.0 38.0 41.0 26-27 39.815250000000006 41.0 40.0 41.0 38.0 41.0 28-29 39.659499999999994 41.0 40.0 41.0 37.5 41.0 30-31 39.271375 41.0 40.0 41.0 37.0 41.0 32-33 39.526624999999996 41.0 40.0 41.0 37.0 41.0 34-35 39.460125000000005 41.0 40.0 41.0 37.0 41.0 36-37 39.393874999999994 41.0 40.0 41.0 37.0 41.0 38-39 39.425875000000005 41.0 39.5 41.0 37.0 41.0 40-41 39.170375 40.5 39.0 41.0 36.0 41.0 42-43 39.154125 40.5 39.0 41.0 36.0 41.0 44-45 38.991749999999996 40.5 38.5 41.0 35.5 41.0 46-47 39.091375 41.0 39.0 41.0 35.5 41.0 48-49 39.00875 40.5 39.0 41.0 35.5 41.0 50-51 39.106750000000005 41.0 39.0 41.0 36.0 41.0 52-53 39.163875000000004 41.0 39.0 41.0 35.5 41.0 54-55 39.10525 41.0 39.0 41.0 35.0 41.0 56-57 38.892875000000004 41.0 39.0 41.0 35.0 41.0 58-59 38.728125000000006 40.0 38.0 41.0 35.0 41.0 60-61 38.527125 40.0 37.5 41.0 35.0 41.0 62-63 38.157250000000005 40.0 37.0 41.0 34.5 41.0 64-65 37.884 39.0 36.5 41.0 34.0 41.0 66-67 37.58725 39.0 36.0 41.0 34.0 41.0 68-69 37.198750000000004 38.5 35.5 40.5 34.0 41.0 70-71 36.815250000000006 37.0 35.0 40.0 34.0 41.0 72-73 36.3725 37.0 35.0 39.0 33.0 41.0 74-75 35.916 36.5 35.0 39.0 33.0 40.5 76-77 35.014624999999995 35.5 34.5 37.0 31.5 39.0 78-79 35.194 35.5 35.0 37.0 33.0 39.0 80-81 34.880750000000006 35.0 35.0 37.0 33.0 38.5 82-83 34.570125000000004 35.0 35.0 36.0 32.5 37.0 84-85 34.316375 35.0 35.0 36.0 32.0 37.0 86-87 34.104875 35.0 35.0 36.0 32.0 36.5 88-89 33.707875 35.0 34.5 35.0 31.5 36.0 90-91 33.649125 35.0 34.0 35.0 31.5 36.0 92-93 33.56075 35.0 34.0 35.0 31.0 36.0 94-95 33.521125 35.0 34.0 35.0 31.5 36.0 96-97 33.329125 35.0 34.0 35.0 31.0 35.0 98-99 33.14075 35.0 34.0 35.0 31.0 35.0 100 33.01125 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 5.0 12 3.0 13 2.0 14 4.0 15 3.0 16 1.0 17 4.0 18 2.0 19 4.0 20 3.0 21 4.0 22 4.0 23 2.0 24 5.0 25 5.0 26 8.0 27 19.0 28 19.0 29 17.0 30 29.0 31 39.0 32 58.0 33 62.0 34 93.0 35 151.0 36 301.0 37 795.0 38 1829.0 39 527.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.05 15.65 15.325 44.975 2 19.325 24.15 37.9 18.625 3 22.25 27.500000000000004 27.474999999999998 22.775000000000002 4 24.0 33.550000000000004 18.9 23.549999999999997 5 22.975 36.225 22.6 18.2 6 18.5 38.025 24.675 18.8 7 17.275 18.525 43.35 20.849999999999998 8 19.2 23.625 29.9 27.275 9 18.775 23.0 32.675 25.55 10-11 21.975 33.7125 22.45 21.8625 12-13 20.2125 27.250000000000004 29.9625 22.575 14-15 21.762500000000003 26.900000000000002 29.1875 22.15 16-17 21.7375 28.212500000000002 27.537499999999998 22.5125 18-19 21.712500000000002 28.812500000000004 27.4125 22.0625 20-21 21.45 28.549999999999997 27.8875 22.112499999999997 22-23 21.512500000000003 29.875 26.387500000000003 22.225 24-25 21.12376423476411 29.00763358778626 27.856338380678263 22.012263796771368 26-27 21.9375 28.4375 27.525 22.1 28-29 21.932573004135858 29.489911016418098 26.795337761624268 21.782178217821784 30-31 21.893045443133317 28.797388902837056 27.17800652774291 22.131559126286717 32-33 21.5 29.062500000000004 27.450000000000003 21.987499999999997 34-35 21.8 27.625 28.1 22.475 36-37 21.587500000000002 29.1875 27.875 21.349999999999998 38-39 22.8875 28.212500000000002 26.8375 22.0625 40-41 21.5 28.9125 27.3625 22.225 42-43 21.5 28.275 28.025 22.2 44-45 21.0625 28.1 28.799999999999997 22.037499999999998 46-47 22.425 27.675 27.8625 22.037499999999998 48-49 22.175 27.925 27.1375 22.7625 50-51 22.2625 28.962500000000002 26.650000000000002 22.125 52-53 22.0625 29.4125 27.200000000000003 21.325 54-55 22.35 28.275 27.474999999999998 21.9 56-57 22.45 28.1875 27.725 21.637500000000003 58-59 21.637500000000003 28.075 28.849999999999998 21.4375 60-61 22.15 27.787499999999998 27.3125 22.75 62-63 22.0125 28.225 27.762500000000003 22.0 64-65 21.55 27.762500000000003 28.537499999999998 22.15 66-67 21.8125 28.65 27.2625 22.275 68-69 21.637500000000003 28.025 27.975 22.3625 70-71 22.0625 28.849999999999998 27.675 21.4125 72-73 21.675 27.875 28.7375 21.712500000000002 74-75 22.6375 27.9125 28.025 21.425 76-77 22.037499999999998 28.15 27.825 21.987499999999997 78-79 21.925 28.1 27.5125 22.4625 80-81 22.075 28.3125 27.6875 21.925 82-83 21.375 28.8625 28.3375 21.425 84-85 21.912499999999998 28.3125 27.3625 22.412499999999998 86-87 21.6625 28.4125 28.1125 21.8125 88-89 22.8375 27.474999999999998 28.199999999999996 21.4875 90-91 22.15 28.487499999999997 27.987499999999997 21.375 92-93 22.325 28.175 27.487499999999997 22.0125 94-95 22.8875 28.037499999999998 27.875 21.2 96-97 23.8125 27.525 27.4125 21.25 98-99 22.3375 28.175 27.287499999999998 22.2 100 21.6 29.849999999999998 26.775 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 3.5 25 4.0 26 3.0 27 7.5 28 9.0 29 7.5 30 13.0 31 28.5 32 38.5 33 44.0 34 52.5 35 59.0 36 78.5 37 114.5 38 142.5 39 169.0 40 208.0 41 236.0 42 249.5 43 251.0 44 273.0 45 292.0 46 276.5 47 255.0 48 229.0 49 194.0 50 160.0 51 133.0 52 102.0 53 85.5 54 65.0 55 44.5 56 37.0 57 29.5 58 24.5 59 17.0 60 11.0 61 10.5 62 9.0 63 4.5 64 4.0 65 4.0 66 4.0 67 2.5 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.11249999999999999 26-27 0.0 28-29 0.2625 30-31 0.42500000000000004 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185263 spots for SRR3207951.sra Written 1185263 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra Read 1185254 spots for SRR3207951.sra Written 1185254 spots for SRR3207951.sra SRR ids: ['SRR3207951.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e691e6y1 SRR3207951.sra spots: 23705089 blocks: [[1, 1185254], [1185255, 2370508], [2370509, 3555762], [3555763, 4741016], [4741017, 5926270], [5926271, 7111524], [7111525, 8296778], [8296779, 9482032], [9482033, 10667286], [10667287, 11852540], [11852541, 13037794], [13037795, 14223048], [14223049, 15408302], [15408303, 16593556], [16593557, 17778810], [17778811, 18964064], [18964065, 20149318], [20149319, 21334572], [21334573, 22519826], [22519827, 23705089]] SRR3207951 file size 6158299 SRR3207951 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207951 SRR3207951_1.fastq Input file: SRR3207951_1.fastq trimmed: SRR3207951-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:38:38 2025 >> started Tue Feb 11 20:38:49 2025 >> done (11.245s) 23705089 reads processed; of these: 3965 ( 0.02%) short reads filtered out after trimming by size control 30963 ( 0.13%) empty reads filtered out after trimming by size control 23670161 (99.85%) reads available; of these: 1018034 ( 4.30%) trimmed reads available after processing 22652127 (95.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 520 0.00% 19 661 0.00% 20 1555 0.01% 21 886 0.00% 22 1194 0.01% 23 1705 0.01% 24 2233 0.01% 25 2777 0.01% 26 3814 0.02% 27 3263 0.01% 28 3163 0.01% 29 3145 0.01% 30 2874 0.01% 31 3104 0.01% 32 3354 0.01% 33 3382 0.01% 34 3531 0.01% 35 3803 0.02% 36 3898 0.02% 37 3924 0.02% 38 4022 0.02% 39 4156 0.02% 40 4193 0.02% 41 4386 0.02% 42 4594 0.02% 43 4773 0.02% 44 4978 0.02% 45 4923 0.02% 46 5370 0.02% 47 5535 0.02% 48 5433 0.02% 49 5650 0.02% 50 5630 0.02% 51 6042 0.03% 52 6378 0.03% 53 6901 0.03% 54 7465 0.03% 55 6403 0.03% 56 6665 0.03% 57 6756 0.03% 58 6950 0.03% 59 7124 0.03% 60 7366 0.03% 61 7626 0.03% 62 7865 0.03% 63 7971 0.03% 64 8082 0.03% 65 8534 0.04% 66 8975 0.04% 67 9085 0.04% 68 9347 0.04% 69 9383 0.04% 70 9864 0.04% 71 10279 0.04% 72 10690 0.05% 73 11292 0.05% 74 11640 0.05% 75 11519 0.05% 76 8219 0.03% 77 9220 0.04% 78 10480 0.04% 79 11533 0.05% 80 12206 0.05% 81 13044 0.06% 82 14110 0.06% 83 14642 0.06% 84 15867 0.07% 85 16565 0.07% 86 17358 0.07% 87 18743 0.08% 88 20280 0.09% 89 22554 0.10% 90 24451 0.10% 91 27462 0.12% 92 30972 0.13% 93 35571 0.15% 94 41369 0.17% 95 48001 0.20% 96 56473 0.24% 97 66804 0.28% 98 76823 0.32% 99 78656 0.33% 100 22652127 95.70% 23670161 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=10.49 fanout-score-rank=13 prefix-density=0.07 prefix-fanout=10.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=283.32 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.2 sequence=TTCTTCTTCTTT Started job on | Feb 11 20:39:09 Started mapping on | Feb 11 20:39:09 Finished on | Feb 11 20:39:33 Mapping speed, Million of reads per hour | 3550.52 Number of input reads | 23670161 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 22602164 Uniquely mapped reads % | 95.49% Average mapped length | 98.94 Number of splices: Total | 6843105 Number of splices: Annotated (sjdb) | 6729266 Number of splices: GT/AG | 6740450 Number of splices: GC/AG | 85444 Number of splices: AT/AC | 6796 Number of splices: Non-canonical | 10415 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 528894 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 70522 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 539103 539103 539103 N_multimapping 528894 528894 528894 N_noFeature 858958 11629805 11680396 N_ambiguous 222417 35703 36071 UnstrandedReadsAssigned:21520789 PositiveStrandReadsAssigned:10936656 NegativeStrandReadsAssigned:10885697 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207951 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207951-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,670,161 reads, 22,020,600 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR3207951.ke.tsv 34699 SRR3207951.se.tsv 87100 total ==> SRR3207951.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 485 16.6183 Potri.005G024800.1.v4.1 1035 936 88 6.18196 Potri.004G059700.1.v4.1 961 862 32 2.44097 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 349.23 8.07423 Potri.016G087400.1.v4.1 270 171 882 339.15 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 45 1.76757 Potri.012G127500.1.v4.1 977 878 3240 242.644 ==> SRR3207951.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1746 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 377 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 79 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207951 completed mapping pipeline successfully