Starting /dee2/code/volunteer_pipeline.sh SRR3207952 current disk space = 3052909154304 free memory = 1507781640 SRR3207952 SRAfilesize 6f02c5f4262c15cd6de6acdcd259d2a2 SRR3207952.sra SRR3207952.sra file validated SRR3207952 is single end SRR3207952 is conventional basespace SRR3207952 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207952_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05925 34.0 33.0 34.0 31.0 34.0 2 33.23125 34.0 34.0 34.0 31.0 34.0 3 33.3005 34.0 34.0 34.0 31.0 34.0 4 36.60175 37.0 37.0 37.0 35.0 37.0 5 36.4845 37.0 37.0 37.0 35.0 37.0 6 36.499 37.0 37.0 37.0 35.0 37.0 7 36.47025 37.0 37.0 37.0 35.0 37.0 8 36.48475 37.0 37.0 37.0 35.0 37.0 9 38.4055 39.0 39.0 39.0 37.0 39.0 10-11 38.3845 39.0 39.0 39.0 37.0 39.0 12-13 38.318625 39.0 39.0 39.0 37.0 39.0 14-15 39.905375 41.0 40.0 41.0 38.0 41.0 16-17 39.945125000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.89775 41.0 40.0 41.0 38.0 41.0 20-21 39.903999999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.805 41.0 40.0 41.0 37.5 41.0 24-25 39.835 41.0 40.0 41.0 38.0 41.0 26-27 39.6655 41.0 40.0 41.0 37.5 41.0 28-29 39.517125 41.0 40.0 41.0 37.0 41.0 30-31 39.5355 41.0 40.0 41.0 37.5 41.0 32-33 39.1955 41.0 39.5 41.0 36.5 41.0 34-35 39.261625 41.0 39.0 41.0 36.0 41.0 36-37 39.31225 41.0 39.0 41.0 36.0 41.0 38-39 39.254999999999995 41.0 39.0 41.0 36.0 41.0 40-41 39.07425 41.0 39.0 41.0 35.5 41.0 42-43 39.087374999999994 40.5 39.0 41.0 36.0 41.0 44-45 39.057375 41.0 39.0 41.0 35.5 41.0 46-47 38.7945 40.5 39.0 41.0 35.0 41.0 48-49 38.860125 40.0 39.0 41.0 35.0 41.0 50-51 39.06125 41.0 39.0 41.0 35.5 41.0 52-53 39.143125 41.0 39.0 41.0 36.0 41.0 54-55 38.878874999999994 41.0 39.0 41.0 35.0 41.0 56-57 38.808375 41.0 39.0 41.0 35.0 41.0 58-59 38.641999999999996 40.5 38.5 41.0 35.0 41.0 60-61 38.228375 40.0 37.5 41.0 34.0 41.0 62-63 38.11575 40.0 37.0 41.0 34.0 41.0 64-65 37.9465 39.0 37.0 41.0 34.0 41.0 66-67 37.593 39.0 36.0 41.0 34.0 41.0 68-69 37.07625 38.5 35.5 40.5 33.0 41.0 70-71 36.78 37.5 35.0 39.5 33.5 41.0 72-73 36.348875 37.0 35.0 39.0 33.0 41.0 74-75 35.75125 36.5 35.0 39.0 32.5 40.5 76-77 34.867125 35.5 34.5 37.0 30.5 39.0 78-79 34.950874999999996 35.5 35.0 37.0 32.0 39.0 80-81 34.729375000000005 35.0 35.0 37.0 32.0 38.5 82-83 34.419124999999994 35.0 35.0 36.0 32.0 37.0 84-85 34.195125 35.0 35.0 36.0 32.0 37.0 86-87 33.995125 35.0 35.0 36.0 32.0 36.5 88-89 33.814499999999995 35.0 35.0 35.0 32.0 36.0 90-91 33.664874999999995 35.0 34.5 35.0 32.0 36.0 92-93 33.431 35.0 34.0 35.0 31.0 36.0 94-95 33.306375 35.0 34.0 35.0 31.0 36.0 96-97 33.2535 35.0 34.0 35.0 31.0 35.0 98-99 32.937375 35.0 34.0 35.0 30.5 35.0 100 32.601 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 3.0 11 4.0 12 5.0 13 2.0 14 1.0 15 1.0 16 4.0 17 5.0 18 5.0 19 2.0 20 4.0 21 5.0 22 3.0 23 4.0 24 13.0 25 6.0 26 11.0 27 12.0 28 22.0 29 24.0 30 33.0 31 48.0 32 49.0 33 76.0 34 104.0 35 133.0 36 293.0 37 797.0 38 1807.0 39 522.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.074999999999996 17.7 12.15 45.074999999999996 2 20.525 24.275 36.875 18.325 3 20.65 28.599999999999998 26.775 23.974999999999998 4 22.650000000000002 34.475 21.075 21.8 5 24.91868901676257 34.30072554415812 22.416812609457093 18.363772829622217 6 19.475 37.75 23.75 19.025 7 15.55 20.4 43.675000000000004 20.375 8 17.549999999999997 22.650000000000002 31.900000000000002 27.900000000000002 9 20.674999999999997 22.75 30.825000000000003 25.75 10-11 22.0125 33.2125 23.225 21.55 12-13 20.575 26.8625 29.512500000000003 23.05 14-15 21.2625 28.7 27.925 22.112499999999997 16-17 21.0 28.849999999999998 28.4 21.75 18-19 21.837500000000002 28.95 26.25 22.9625 20-21 22.675 27.925 27.8625 21.5375 22-23 21.512500000000003 28.425 27.8125 22.25 24-25 22.719879894908043 27.711747779306894 27.98698861503816 21.581383710746906 26-27 22.3375 28.6125 27.8125 21.2375 28-29 22.35985985985986 28.47847847847848 27.077077077077078 22.084584584584587 30-31 21.16660408061084 28.902240580798598 28.1136562773814 21.817499061209162 32-33 22.05 28.6625 27.224999999999998 22.0625 34-35 22.425 28.625 27.0875 21.8625 36-37 22.412499999999998 28.349999999999998 27.8875 21.349999999999998 38-39 22.650000000000002 29.1375 25.8125 22.400000000000002 40-41 21.3125 29.175 27.6125 21.9 42-43 22.475 28.1 27.05 22.375 44-45 21.725 27.6375 28.3375 22.3 46-47 21.4875 28.225 28.325 21.9625 48-49 21.6125 28.675 26.700000000000003 23.0125 50-51 22.4875 28.1125 27.8375 21.5625 52-53 22.35 28.1625 27.3125 22.175 54-55 21.5 28.299999999999997 27.6625 22.537499999999998 56-57 21.925 27.474999999999998 28.1875 22.412499999999998 58-59 21.1625 28.349999999999998 28.462500000000002 22.025 60-61 22.1375 28.525 27.6625 21.675 62-63 22.0875 28.1875 28.9 20.825 64-65 21.8625 28.125 28.050000000000004 21.9625 66-67 21.8125 27.5875 28.4125 22.1875 68-69 23.200000000000003 28.1625 27.537499999999998 21.099999999999998 70-71 22.4625 28.449999999999996 27.537499999999998 21.55 72-73 21.912499999999998 28.175 27.425 22.4875 74-75 22.237499999999997 27.900000000000002 27.987499999999997 21.875 76-77 22.0625 29.312500000000004 27.1625 21.462500000000002 78-79 22.287499999999998 28.487499999999997 27.5875 21.637500000000003 80-81 21.9625 28.375 27.537499999999998 22.125 82-83 22.825 28.449999999999996 27.737499999999997 20.9875 84-85 23.225 27.775 27.525 21.475 86-87 22.0 28.449999999999996 27.625 21.925 88-89 21.6125 28.425 28.249999999999996 21.712500000000002 90-91 22.037499999999998 28.15 28.4 21.4125 92-93 21.975 27.3875 28.3125 22.325 94-95 21.6 27.962500000000002 28.175 22.2625 96-97 22.3875 27.4125 28.000000000000004 22.2 98-99 21.9 28.1875 27.925 21.987499999999997 100 22.15 27.1 28.475 22.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 2.5 26 1.5 27 3.0 28 8.0 29 14.5 30 16.5 31 25.5 32 41.5 33 53.5 34 60.0 35 62.5 36 87.5 37 117.0 38 137.5 39 173.0 40 191.5 41 214.5 42 227.0 43 252.5 44 282.5 45 279.5 46 277.0 47 258.0 48 225.5 49 188.0 50 162.5 51 146.5 52 118.5 53 87.0 54 62.0 55 46.0 56 39.0 57 27.5 58 19.0 59 15.5 60 14.5 61 11.0 62 6.5 63 4.5 64 7.5 65 6.0 66 4.0 67 4.5 68 2.5 69 2.5 70 2.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.08750000000000001 26-27 0.0 28-29 0.1 30-31 0.13749999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra Read 662210 spots for SRR3207952.sra Written 662210 spots for SRR3207952.sra SRR ids: ['SRR3207952.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sjjn8n3b SRR3207952.sra spots: 13244200 blocks: [[1, 662210], [662211, 1324420], [1324421, 1986630], [1986631, 2648840], [2648841, 3311050], [3311051, 3973260], [3973261, 4635470], [4635471, 5297680], [5297681, 5959890], [5959891, 6622100], [6622101, 7284310], [7284311, 7946520], [7946521, 8608730], [8608731, 9270940], [9270941, 9933150], [9933151, 10595360], [10595361, 11257570], [11257571, 11919780], [11919781, 12581990], [12581991, 13244200]] SRR3207952 file size 3435897 SRR3207952 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207952 SRR3207952_1.fastq Input file: SRR3207952_1.fastq trimmed: SRR3207952-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:39:34 2025 >> started Tue Feb 11 20:39:44 2025 >> done (9.365s) 13244200 reads processed; of these: 1943 ( 0.01%) short reads filtered out after trimming by size control 15570 ( 0.12%) empty reads filtered out after trimming by size control 13226687 (99.87%) reads available; of these: 577240 ( 4.36%) trimmed reads available after processing 12649447 (95.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 246 0.00% 19 349 0.00% 20 788 0.01% 21 496 0.00% 22 638 0.00% 23 885 0.01% 24 1222 0.01% 25 1495 0.01% 26 2160 0.02% 27 2311 0.02% 28 1921 0.01% 29 1978 0.01% 30 1796 0.01% 31 1828 0.01% 32 1801 0.01% 33 1915 0.01% 34 2111 0.02% 35 2105 0.02% 36 2090 0.02% 37 2145 0.02% 38 2188 0.02% 39 2298 0.02% 40 2325 0.02% 41 2495 0.02% 42 2578 0.02% 43 2591 0.02% 44 2711 0.02% 45 2745 0.02% 46 2822 0.02% 47 2933 0.02% 48 2991 0.02% 49 3180 0.02% 50 3024 0.02% 51 3130 0.02% 52 3248 0.02% 53 3421 0.03% 54 3622 0.03% 55 3763 0.03% 56 3821 0.03% 57 3980 0.03% 58 4071 0.03% 59 4211 0.03% 60 4304 0.03% 61 4301 0.03% 62 4490 0.03% 63 4556 0.03% 64 4826 0.04% 65 4780 0.04% 66 4959 0.04% 67 5238 0.04% 68 5288 0.04% 69 5324 0.04% 70 5535 0.04% 71 5788 0.04% 72 6081 0.05% 73 6151 0.05% 74 6576 0.05% 75 6558 0.05% 76 4665 0.04% 77 5227 0.04% 78 5891 0.04% 79 6338 0.05% 80 6849 0.05% 81 7314 0.06% 82 7861 0.06% 83 8524 0.06% 84 8884 0.07% 85 9215 0.07% 86 9988 0.08% 87 11009 0.08% 88 11477 0.09% 89 12580 0.10% 90 13937 0.11% 91 15746 0.12% 92 17820 0.13% 93 19823 0.15% 94 23532 0.18% 95 26766 0.20% 96 32106 0.24% 97 37712 0.29% 98 42333 0.32% 99 48460 0.37% 100 12649447 95.64% 13226687 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=11.39 fanout-score-rank=5 prefix-density=0.08 prefix-fanout=11.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=43.63 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.5 sequence=AAGAAAAGAAAA Started job on | Feb 11 20:40:02 Started mapping on | Feb 11 20:40:03 Finished on | Feb 11 20:40:23 Mapping speed, Million of reads per hour | 2380.80 Number of input reads | 13226687 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12481088 Uniquely mapped reads % | 94.36% Average mapped length | 98.96 Number of splices: Total | 3638447 Number of splices: Annotated (sjdb) | 3574865 Number of splices: GT/AG | 3585127 Number of splices: GC/AG | 43805 Number of splices: AT/AC | 3835 Number of splices: Non-canonical | 5680 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289559 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 45790 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 456040 456040 456040 N_multimapping 289559 289559 289559 N_noFeature 492267 6411370 6467013 N_ambiguous 136194 20512 20856 UnstrandedReadsAssigned:11852627 PositiveStrandReadsAssigned:6049206 NegativeStrandReadsAssigned:5993219 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207952 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207952-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,226,687 reads, 12,146,515 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR3207952.ke.tsv 34699 SRR3207952.se.tsv 87100 total ==> SRR3207952.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 340 21.5634 Potri.005G024800.1.v4.1 1035 936 61 7.93171 Potri.004G059700.1.v4.1 961 862 70 9.88334 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 215.413 9.21841 Potri.016G087400.1.v4.1 270 171 481 342.343 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 26 1.8903 Potri.012G127500.1.v4.1 977 878 1191 165.094 ==> SRR3207952.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1204 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 68 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207952 completed mapping pipeline successfully