Starting /dee2/code/volunteer_pipeline.sh SRR3207953 current disk space = 3053154148352 free memory = 1428361028 SRR3207953 SRAfilesize 9590dad02ac4a722e264bc986024e3ba SRR3207953.sra SRR3207953.sra file validated SRR3207953 is single end SRR3207953 is conventional basespace SRR3207953 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1145 34.0 33.0 34.0 31.0 34.0 2 33.26875 34.0 34.0 34.0 31.0 34.0 3 33.2975 34.0 34.0 34.0 31.0 34.0 4 36.5695 37.0 37.0 37.0 35.0 37.0 5 36.44475 37.0 37.0 37.0 35.0 37.0 6 36.4615 37.0 37.0 37.0 35.0 37.0 7 36.5325 37.0 37.0 37.0 35.0 37.0 8 36.4445 37.0 37.0 37.0 35.0 37.0 9 38.3845 39.0 39.0 39.0 37.0 39.0 10-11 38.379374999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.304 39.0 39.0 39.0 37.0 39.0 14-15 39.929500000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.90575 41.0 40.0 41.0 38.0 41.0 18-19 39.886624999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.944625 41.0 40.0 41.0 38.0 41.0 22-23 39.851375 41.0 40.0 41.0 38.0 41.0 24-25 39.69 41.0 40.0 41.0 37.5 41.0 26-27 39.662875 41.0 40.0 41.0 37.0 41.0 28-29 39.425124999999994 41.0 40.0 41.0 37.0 41.0 30-31 39.383625 41.0 40.0 41.0 37.0 41.0 32-33 39.0875 41.0 39.5 41.0 36.0 41.0 34-35 39.276125 41.0 39.0 41.0 36.0 41.0 36-37 39.23975 41.0 39.0 41.0 36.0 41.0 38-39 39.188375 41.0 39.0 41.0 36.0 41.0 40-41 39.037125 40.5 39.0 41.0 35.5 41.0 42-43 39.04975 40.5 39.0 41.0 35.5 41.0 44-45 39.044 41.0 39.0 41.0 35.5 41.0 46-47 38.888000000000005 40.5 39.0 41.0 35.5 41.0 48-49 38.85875 40.0 39.0 41.0 35.0 41.0 50-51 39.04625 41.0 39.0 41.0 35.0 41.0 52-53 39.095375000000004 41.0 39.0 41.0 35.5 41.0 54-55 38.903125 41.0 39.0 41.0 35.0 41.0 56-57 38.85025 41.0 39.0 41.0 35.0 41.0 58-59 38.672875000000005 40.0 38.5 41.0 35.0 41.0 60-61 38.235 40.0 37.0 41.0 34.0 41.0 62-63 38.11024999999999 40.0 37.0 41.0 34.0 41.0 64-65 37.839625 39.0 37.0 41.0 34.0 41.0 66-67 37.49675 39.0 36.0 41.0 34.0 41.0 68-69 37.059 38.5 35.5 40.5 33.5 41.0 70-71 36.704625 37.0 35.0 40.0 33.5 41.0 72-73 36.3085 37.0 35.0 39.0 33.0 41.0 74-75 35.788624999999996 36.5 35.0 39.0 32.5 40.5 76-77 34.893125 36.0 34.5 37.0 31.5 39.0 78-79 34.847 35.5 35.0 37.0 32.0 39.0 80-81 34.683125000000004 35.0 35.0 37.0 32.0 39.0 82-83 34.372749999999996 35.0 35.0 36.0 32.0 37.0 84-85 34.134625 35.0 35.0 36.0 32.0 37.0 86-87 33.888625000000005 35.0 35.0 36.0 32.0 36.5 88-89 33.77625 35.0 35.0 35.0 32.0 36.0 90-91 33.575375 35.0 34.0 35.0 31.0 36.0 92-93 33.3515 35.0 34.0 35.0 31.0 36.0 94-95 33.201375 35.0 34.0 35.0 31.0 35.5 96-97 33.226875 35.0 34.0 35.0 31.0 35.0 98-99 32.97475 35.0 34.0 35.0 30.5 35.0 100 32.72375 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 2.0 13 3.0 14 2.0 15 5.0 16 3.0 17 6.0 18 4.0 19 6.0 20 3.0 21 9.0 22 5.0 23 6.0 24 7.0 25 11.0 26 8.0 27 12.0 28 16.0 29 25.0 30 30.0 31 36.0 32 63.0 33 73.0 34 109.0 35 174.0 36 247.0 37 786.0 38 1780.0 39 561.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.799999999999997 18.125 14.149999999999999 43.925 2 19.575 24.025 36.7 19.7 3 19.925 28.249999999999996 27.800000000000004 24.025 4 23.775 33.6 20.7 21.925 5 24.2992992992993 34.234234234234236 23.2982982982983 18.16816816816817 6 18.3 38.15 24.325 19.225 7 17.375 18.5 44.2 19.925 8 18.95 21.525 30.825000000000003 28.7 9 19.025 23.150000000000002 33.125 24.7 10-11 22.8 33.7125 22.3875 21.099999999999998 12-13 20.549999999999997 26.687499999999996 30.5 22.2625 14-15 20.1625 27.85 29.049999999999997 22.9375 16-17 20.7125 28.6375 28.0875 22.5625 18-19 22.3625 27.9375 27.900000000000002 21.8 20-21 21.837500000000002 28.125 27.725 22.3125 22-23 21.512500000000003 28.7 27.9375 21.85 24-25 21.127113337507826 28.991859737006887 27.62680025046963 22.254226675015655 26-27 21.85 28.275 28.3125 21.5625 28-29 22.296027071061538 27.823035468103775 27.62250908635167 22.258428374483017 30-31 21.72768304914744 28.00902708124373 27.695586760280843 22.567703109327983 32-33 21.7375 29.1125 28.125 21.025 34-35 21.912499999999998 28.725 27.0625 22.3 36-37 21.65 28.375 27.950000000000003 22.025 38-39 22.4375 27.925 27.35 22.287499999999998 40-41 21.462500000000002 27.9125 28.625 22.0 42-43 21.2875 28.237499999999997 28.349999999999998 22.125 44-45 22.425 27.925 27.6625 21.987499999999997 46-47 22.3875 28.3375 28.025 21.25 48-49 21.837500000000002 28.525 27.5625 22.075 50-51 21.3625 28.249999999999996 28.499999999999996 21.8875 52-53 21.212500000000002 28.799999999999997 27.650000000000002 22.3375 54-55 21.675 28.6625 27.625 22.037499999999998 56-57 22.25 28.4 28.000000000000004 21.349999999999998 58-59 21.8625 28.875 27.9125 21.349999999999998 60-61 20.925 28.775000000000002 27.875 22.425 62-63 21.8875 27.762500000000003 28.4 21.95 64-65 21.575 29.012500000000003 28.212500000000002 21.2 66-67 22.1 26.900000000000002 28.5875 22.412499999999998 68-69 21.6875 28.3125 27.6 22.400000000000002 70-71 21.1375 28.5625 28.175 22.125 72-73 21.575 28.7 28.812500000000004 20.9125 74-75 22.175 26.9125 28.462500000000002 22.45 76-77 21.875 27.8125 28.1 22.2125 78-79 21.8875 28.487499999999997 27.900000000000002 21.725 80-81 22.1375 27.737499999999997 28.1125 22.0125 82-83 21.85 28.6875 27.375 22.0875 84-85 22.6125 28.775000000000002 27.1125 21.5 86-87 22.05 28.3375 28.000000000000004 21.6125 88-89 21.8625 27.237499999999997 29.125 21.775 90-91 22.237499999999997 28.0625 26.825 22.875 92-93 21.975 27.750000000000004 28.65 21.625 94-95 22.075 27.737499999999997 28.299999999999997 21.8875 96-97 22.325 27.8875 27.6625 22.125 98-99 21.9625 28.799999999999997 27.537499999999998 21.7 100 21.6 28.050000000000004 29.225 21.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 3.0 24 3.5 25 5.0 26 6.0 27 10.0 28 13.5 29 11.0 30 14.5 31 22.5 32 33.0 33 42.0 34 52.0 35 76.0 36 94.5 37 111.5 38 139.0 39 166.0 40 197.5 41 229.0 42 260.5 43 270.0 44 265.5 45 269.0 46 262.0 47 254.5 48 231.0 49 187.5 50 166.0 51 144.0 52 114.0 53 94.0 54 67.0 55 46.0 56 34.0 57 24.0 58 16.5 59 14.0 60 13.0 61 9.5 62 5.5 63 3.5 64 5.0 65 5.0 66 3.0 67 1.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.1875 26-27 0.0 28-29 0.2625 30-31 0.3 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.0875 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.16249999999999998 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805964 spots for SRR3207953.sra Written 805964 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra Read 805954 spots for SRR3207953.sra Written 805954 spots for SRR3207953.sra SRR ids: ['SRR3207953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bgg0grvu SRR3207953.sra spots: 16119090 blocks: [[1, 805954], [805955, 1611908], [1611909, 2417862], [2417863, 3223816], [3223817, 4029770], [4029771, 4835724], [4835725, 5641678], [5641679, 6447632], [6447633, 7253586], [7253587, 8059540], [8059541, 8865494], [8865495, 9671448], [9671449, 10477402], [10477403, 11283356], [11283357, 12089310], [12089311, 12895264], [12895265, 13701218], [13701219, 14507172], [14507173, 15313126], [15313127, 16119090]] SRR3207953 file size 4184081 SRR3207953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207953 SRR3207953_1.fastq Input file: SRR3207953_1.fastq trimmed: SRR3207953-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:15:59 2025 >> started Tue Feb 11 20:16:07 2025 >> done (7.989s) 16119090 reads processed; of these: 2537 ( 0.02%) short reads filtered out after trimming by size control 23851 ( 0.15%) empty reads filtered out after trimming by size control 16092702 (99.84%) reads available; of these: 696475 ( 4.33%) trimmed reads available after processing 15396227 (95.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 355 0.00% 19 403 0.00% 20 404 0.00% 21 604 0.00% 22 802 0.00% 23 1063 0.01% 24 1507 0.01% 25 1943 0.01% 26 2753 0.02% 27 2818 0.02% 28 2458 0.02% 29 2330 0.01% 30 2240 0.01% 31 2090 0.01% 32 2255 0.01% 33 2318 0.01% 34 2530 0.02% 35 2391 0.01% 36 2548 0.02% 37 2546 0.02% 38 2673 0.02% 39 2774 0.02% 40 2897 0.02% 41 3056 0.02% 42 3066 0.02% 43 3127 0.02% 44 3306 0.02% 45 3420 0.02% 46 3498 0.02% 47 3414 0.02% 48 3560 0.02% 49 3782 0.02% 50 3736 0.02% 51 3853 0.02% 52 4034 0.03% 53 3994 0.02% 54 4429 0.03% 55 4525 0.03% 56 4689 0.03% 57 4815 0.03% 58 4904 0.03% 59 4923 0.03% 60 5171 0.03% 61 5269 0.03% 62 5300 0.03% 63 5446 0.03% 64 5789 0.04% 65 5989 0.04% 66 6085 0.04% 67 6287 0.04% 68 6528 0.04% 69 6441 0.04% 70 6888 0.04% 71 7270 0.05% 72 7684 0.05% 73 7746 0.05% 74 7906 0.05% 75 7941 0.05% 76 5637 0.04% 77 6288 0.04% 78 7384 0.05% 79 7766 0.05% 80 8212 0.05% 81 8821 0.05% 82 9571 0.06% 83 10418 0.06% 84 10774 0.07% 85 11240 0.07% 86 11974 0.07% 87 13019 0.08% 88 13962 0.09% 89 15277 0.09% 90 16605 0.10% 91 18646 0.12% 92 20930 0.13% 93 23819 0.15% 94 27727 0.17% 95 32683 0.20% 96 38493 0.24% 97 44871 0.28% 98 50793 0.32% 99 58992 0.37% 100 15396227 95.67% 16092702 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=28 prefix-density=0.09 prefix-fanout=2.6 sequence=GGTGCAAAGATGGTTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=186.26 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=22.8 sequence=AAGAAGAAGAAA Started job on | Feb 11 20:16:25 Started mapping on | Feb 11 20:16:25 Finished on | Feb 11 20:16:43 Mapping speed, Million of reads per hour | 3218.54 Number of input reads | 16092702 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15345227 Uniquely mapped reads % | 95.36% Average mapped length | 98.96 Number of splices: Total | 4481748 Number of splices: Annotated (sjdb) | 4403665 Number of splices: GT/AG | 4416906 Number of splices: GC/AG | 53254 Number of splices: AT/AC | 4731 Number of splices: Non-canonical | 6857 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347165 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 45659 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 400310 400310 400310 N_multimapping 347165 347165 347165 N_noFeature 612746 7892309 7949187 N_ambiguous 167477 25396 25783 UnstrandedReadsAssigned:14565004 PositiveStrandReadsAssigned:7427522 NegativeStrandReadsAssigned:7370257 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207953 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207953-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,092,702 reads, 14,911,529 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,252 rounds 52401 SRR3207953.ke.tsv 34699 SRR3207953.se.tsv 87100 total ==> SRR3207953.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 523 27.1071 Potri.005G024800.1.v4.1 1035 936 91 9.6699 Potri.004G059700.1.v4.1 961 862 71 8.19233 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 253.303 8.85864 Potri.016G087400.1.v4.1 270 171 574 333.866 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 28 1.66364 Potri.012G127500.1.v4.1 977 878 1417 160.521 ==> SRR3207953.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1618 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 83 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207953 completed mapping pipeline successfully