Starting /dee2/code/volunteer_pipeline.sh SRR3207954 current disk space = 3052922150912 free memory = 1512652468 SRR3207954 SRAfilesize 99ed2cd5461160eaac50590d4652d364 SRR3207954.sra SRR3207954.sra file validated SRR3207954 is single end SRR3207954 is conventional basespace SRR3207954 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207954_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15925 34.0 33.0 34.0 31.0 34.0 2 33.29275 34.0 34.0 34.0 31.0 34.0 3 33.35775 34.0 34.0 34.0 31.0 34.0 4 36.61025 37.0 37.0 37.0 35.0 37.0 5 36.5315 37.0 37.0 37.0 35.0 37.0 6 36.5345 37.0 37.0 37.0 35.0 37.0 7 36.5095 37.0 37.0 37.0 35.0 37.0 8 36.50775 37.0 37.0 37.0 35.0 37.0 9 38.452 39.0 39.0 39.0 37.0 39.0 10-11 38.459374999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.339625 39.0 39.0 39.0 37.0 39.0 14-15 40.015375 41.0 40.0 41.0 38.0 41.0 16-17 39.995625 41.0 40.0 41.0 38.0 41.0 18-19 39.918625000000006 41.0 40.0 41.0 38.0 41.0 20-21 39.9945 41.0 40.0 41.0 38.0 41.0 22-23 40.008375 41.0 40.0 41.0 38.0 41.0 24-25 39.790875 41.0 40.0 41.0 38.0 41.0 26-27 39.773375 41.0 40.0 41.0 38.0 41.0 28-29 39.533375 41.0 40.0 41.0 37.0 41.0 30-31 39.514625 41.0 40.0 41.0 37.0 41.0 32-33 39.29325 41.0 39.5 41.0 36.5 41.0 34-35 39.382625 41.0 39.0 41.0 36.5 41.0 36-37 39.474875 41.0 40.0 41.0 37.0 41.0 38-39 39.435125 41.0 40.0 41.0 37.0 41.0 40-41 39.241375000000005 41.0 39.0 41.0 36.0 41.0 42-43 39.2525 40.5 39.0 41.0 36.0 41.0 44-45 39.3255 41.0 39.0 41.0 36.0 41.0 46-47 39.09225 41.0 39.0 41.0 35.5 41.0 48-49 39.047625 41.0 39.0 41.0 35.0 41.0 50-51 39.23475 41.0 39.0 41.0 36.0 41.0 52-53 39.264375 41.0 39.0 41.0 36.0 41.0 54-55 39.146125 41.0 39.0 41.0 35.0 41.0 56-57 39.08325 41.0 39.0 41.0 35.0 41.0 58-59 38.846999999999994 41.0 38.5 41.0 35.0 41.0 60-61 38.51475000000001 40.0 38.0 41.0 35.0 41.0 62-63 38.318875 40.0 37.0 41.0 35.0 41.0 64-65 38.068375 39.5 37.0 41.0 34.0 41.0 66-67 37.752250000000004 39.0 36.5 41.0 34.0 41.0 68-69 37.318 39.0 35.5 40.5 34.0 41.0 70-71 36.834625 37.5 35.0 39.5 33.5 41.0 72-73 36.45875 37.0 35.0 39.0 34.0 41.0 74-75 35.944374999999994 36.5 35.0 39.0 33.0 40.5 76-77 35.134125 36.0 34.5 37.0 31.5 39.0 78-79 35.1275 36.0 35.0 37.0 33.0 39.0 80-81 34.8775 35.0 35.0 37.0 33.0 38.5 82-83 34.5195 35.0 35.0 36.0 32.5 37.0 84-85 34.315625 35.0 35.0 36.0 32.0 37.0 86-87 34.17075 35.0 35.0 36.0 33.0 36.5 88-89 33.968375 35.0 35.0 35.0 32.0 36.0 90-91 33.77075 35.0 35.0 35.0 32.0 36.0 92-93 33.570625 35.0 34.0 35.0 32.0 36.0 94-95 33.439750000000004 35.0 34.0 35.0 31.0 36.0 96-97 33.3625 35.0 34.0 35.0 31.5 35.0 98-99 33.134375 35.0 34.0 35.0 31.0 35.0 100 32.9445 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 2.0 14 3.0 15 3.0 16 2.0 17 1.0 18 3.0 19 2.0 20 2.0 21 3.0 22 10.0 23 3.0 24 7.0 25 9.0 26 15.0 27 20.0 28 17.0 29 23.0 30 29.0 31 32.0 32 52.0 33 66.0 34 98.0 35 144.0 36 288.0 37 744.0 38 1860.0 39 558.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.75 17.125 13.775 44.35 2 19.975 24.0 37.225 18.8 3 21.425 27.425 27.700000000000003 23.45 4 24.125 31.1 21.525 23.25 5 23.400000000000002 35.6 22.375 18.625 6 18.775 36.7 24.675 19.85 7 16.075 17.625 45.225 21.075 8 18.725 22.675 30.775000000000002 27.825 9 19.475 23.95 32.175 24.4 10-11 23.2375 33.025 23.125 20.6125 12-13 20.2375 26.724999999999998 29.4375 23.599999999999998 14-15 20.8625 26.9625 29.65 22.525000000000002 16-17 22.0125 27.425 27.9125 22.650000000000002 18-19 21.462500000000002 29.525000000000002 27.325 21.6875 20-21 21.6625 28.512500000000003 27.575 22.25 22-23 21.775 28.787499999999998 27.575 21.8625 24-25 21.39633993482076 28.6287290047631 26.886437703685136 23.08849335673101 26-27 20.962500000000002 28.3375 28.325 22.375 28-29 21.74294670846395 28.61442006269592 27.373040752351095 22.269592476489027 30-31 21.86676703048551 28.25241500439092 28.126960230836783 21.75385773428679 32-33 22.3625 27.875 28.5625 21.2 34-35 21.4125 27.625 28.499999999999996 22.4625 36-37 21.3125 29.037499999999998 27.525 22.125 38-39 22.1875 28.275 27.6375 21.9 40-41 22.162499999999998 28.1125 27.35 22.375 42-43 22.037499999999998 28.249999999999996 28.125 21.587500000000002 44-45 21.625 28.287499999999998 27.712500000000002 22.375 46-47 21.9375 28.449999999999996 27.500000000000004 22.112499999999997 48-49 21.712500000000002 27.8125 28.5875 21.8875 50-51 22.7 28.012500000000003 28.037499999999998 21.25 52-53 23.0125 28.375 26.875 21.7375 54-55 21.3 28.0875 28.4375 22.175 56-57 21.95 28.0875 28.1375 21.825 58-59 21.4375 28.6625 28.3625 21.5375 60-61 21.587500000000002 28.4125 27.6375 22.3625 62-63 22.25 28.012500000000003 28.299999999999997 21.4375 64-65 21.462500000000002 28.525 27.425 22.5875 66-67 22.225 28.7 27.237499999999997 21.837500000000002 68-69 22.1375 27.775 27.6875 22.400000000000002 70-71 21.875 28.125 28.6625 21.337500000000002 72-73 21.2875 27.212500000000002 28.3125 23.1875 74-75 22.1375 27.525 28.487499999999997 21.85 76-77 21.8875 28.1 28.425 21.587500000000002 78-79 22.037499999999998 27.800000000000004 27.55 22.6125 80-81 21.7875 29.0875 27.900000000000002 21.224999999999998 82-83 22.3125 28.025 27.35 22.3125 84-85 21.75 28.1875 28.212500000000002 21.85 86-87 21.625 28.712500000000002 27.950000000000003 21.712500000000002 88-89 22.45 28.8625 27.55 21.1375 90-91 22.0125 28.050000000000004 28.512500000000003 21.425 92-93 22.15 27.725 27.950000000000003 22.175 94-95 21.9375 28.875 28.050000000000004 21.1375 96-97 21.6625 28.575 28.287499999999998 21.475 98-99 22.1375 28.7375 27.05 22.075 100 21.675 28.95 27.625 21.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.5 26 1.5 27 3.5 28 8.5 29 14.0 30 19.5 31 23.5 32 29.5 33 38.5 34 53.5 35 76.5 36 103.5 37 118.0 38 132.5 39 183.5 40 216.0 41 211.5 42 232.5 43 270.5 44 285.0 45 284.5 46 263.5 47 236.5 48 233.0 49 214.5 50 163.0 51 123.0 52 111.0 53 91.0 54 66.0 55 45.5 56 29.0 57 24.5 58 20.5 59 13.5 60 9.0 61 9.5 62 9.5 63 7.0 64 4.5 65 3.0 66 2.5 67 2.0 68 2.0 69 2.0 70 1.5 71 1.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.27499999999999997 26-27 0.0 28-29 0.3125 30-31 0.36250000000000004 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587838 spots for SRR3207954.sra Written 1587838 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra Read 1587834 spots for SRR3207954.sra Written 1587834 spots for SRR3207954.sra SRR ids: ['SRR3207954.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2um_tqjl SRR3207954.sra spots: 31756684 blocks: [[1, 1587834], [1587835, 3175668], [3175669, 4763502], [4763503, 6351336], [6351337, 7939170], [7939171, 9527004], [9527005, 11114838], [11114839, 12702672], [12702673, 14290506], [14290507, 15878340], [15878341, 17466174], [17466175, 19054008], [19054009, 20641842], [20641843, 22229676], [22229677, 23817510], [23817511, 25405344], [25405345, 26993178], [26993179, 28581012], [28581013, 30168846], [30168847, 31756684]] SRR3207954 file size 8253719 SRR3207954 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207954 SRR3207954_1.fastq Input file: SRR3207954_1.fastq trimmed: SRR3207954-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:40:58 2025 >> started Tue Feb 11 20:41:15 2025 >> done (17.195s) 31756684 reads processed; of these: 5656 ( 0.02%) short reads filtered out after trimming by size control 39754 ( 0.13%) empty reads filtered out after trimming by size control 31711274 (99.86%) reads available; of these: 1327467 ( 4.19%) trimmed reads available after processing 30383807 (95.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 702 0.00% 19 1054 0.00% 20 2401 0.01% 21 1146 0.00% 22 1562 0.00% 23 2150 0.01% 24 2900 0.01% 25 3772 0.01% 26 4778 0.02% 27 4718 0.01% 28 4199 0.01% 29 4155 0.01% 30 4120 0.01% 31 4096 0.01% 32 4475 0.01% 33 4317 0.01% 34 4663 0.01% 35 4582 0.01% 36 4927 0.02% 37 5077 0.02% 38 5160 0.02% 39 5521 0.02% 40 5428 0.02% 41 5936 0.02% 42 5948 0.02% 43 6139 0.02% 44 6318 0.02% 45 6447 0.02% 46 6715 0.02% 47 6747 0.02% 48 6983 0.02% 49 7127 0.02% 50 6936 0.02% 51 7480 0.02% 52 7732 0.02% 53 8072 0.03% 54 8389 0.03% 55 8593 0.03% 56 8876 0.03% 57 9050 0.03% 58 9243 0.03% 59 9377 0.03% 60 9675 0.03% 61 10119 0.03% 62 10467 0.03% 63 10346 0.03% 64 10574 0.03% 65 11193 0.04% 66 11518 0.04% 67 11968 0.04% 68 12319 0.04% 69 12186 0.04% 70 12983 0.04% 71 13393 0.04% 72 14358 0.05% 73 14496 0.05% 74 15192 0.05% 75 14937 0.05% 76 10620 0.03% 77 12089 0.04% 78 13605 0.04% 79 14554 0.05% 80 15895 0.05% 81 16539 0.05% 82 17948 0.06% 83 19268 0.06% 84 20417 0.06% 85 21442 0.07% 86 23023 0.07% 87 24995 0.08% 88 26777 0.08% 89 29285 0.09% 90 31967 0.10% 91 35648 0.11% 92 40411 0.13% 93 45063 0.14% 94 53196 0.17% 95 61832 0.19% 96 73306 0.23% 97 86182 0.27% 98 96952 0.31% 99 112718 0.36% 100 30383807 95.81% 31711274 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=7.71 fanout-score-rank=13 prefix-density=0.05 prefix-fanout=7.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=313.73 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.8 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 11 20:41:32 Started mapping on | Feb 11 20:41:33 Finished on | Feb 11 20:42:10 Mapping speed, Million of reads per hour | 3085.42 Number of input reads | 31711274 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 30309406 Uniquely mapped reads % | 95.58% Average mapped length | 98.98 Number of splices: Total | 8864752 Number of splices: Annotated (sjdb) | 8711135 Number of splices: GT/AG | 8734873 Number of splices: GC/AG | 107092 Number of splices: AT/AC | 9168 Number of splices: Non-canonical | 13619 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700307 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 96405 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 701561 701561 701561 N_multimapping 700307 700307 700307 N_noFeature 1163981 15589563 15669172 N_ambiguous 313694 49015 50381 UnstrandedReadsAssigned:28831731 PositiveStrandReadsAssigned:14670828 NegativeStrandReadsAssigned:14589853 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207954 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207954-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,711,274 reads, 29,516,698 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR3207954.ke.tsv 34699 SRR3207954.se.tsv 87100 total ==> SRR3207954.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 947 24.4166 Potri.005G024800.1.v4.1 1035 936 179 9.46209 Potri.004G059700.1.v4.1 961 862 66 3.78832 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 483.621 8.41367 Potri.016G087400.1.v4.1 270 171 1279 370.07 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 52 1.53694 Potri.012G127500.1.v4.1 977 878 3476 195.882 ==> SRR3207954.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2599 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 62 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207954 completed mapping pipeline successfully