Starting /dee2/code/volunteer_pipeline.sh SRR3207955 current disk space = 3053178544128 free memory = 1216443900 SRR3207955 SRAfilesize 2ad111282b92f6391dca04f716cabfaa SRR3207955.sra SRR3207955.sra file validated SRR3207955 is single end SRR3207955 is conventional basespace SRR3207955 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207955_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13175 34.0 33.0 34.0 31.0 34.0 2 33.2865 34.0 34.0 34.0 31.0 34.0 3 33.357 34.0 34.0 34.0 31.0 34.0 4 36.40925 37.0 37.0 37.0 35.0 37.0 5 36.49075 37.0 37.0 37.0 35.0 37.0 6 36.47375 37.0 37.0 37.0 35.0 37.0 7 36.3805 37.0 37.0 37.0 35.0 37.0 8 36.45775 37.0 37.0 37.0 35.0 37.0 9 38.32225 39.0 39.0 39.0 37.0 39.0 10-11 38.326375 39.0 39.0 39.0 37.0 39.0 12-13 38.3455 39.0 39.0 39.0 37.0 39.0 14-15 39.96525 41.0 40.0 41.0 38.0 41.0 16-17 39.997 41.0 40.0 41.0 38.0 41.0 18-19 39.956625 41.0 40.0 41.0 38.0 41.0 20-21 39.891375 41.0 40.0 41.0 38.0 41.0 22-23 39.859125 41.0 40.0 41.0 38.0 41.0 24-25 39.814875 41.0 40.0 41.0 38.0 41.0 26-27 39.76225 41.0 40.0 41.0 37.5 41.0 28-29 39.631125 41.0 40.0 41.0 37.5 41.0 30-31 39.477625 41.0 40.0 41.0 37.0 41.0 32-33 39.551500000000004 41.0 40.0 41.0 37.0 41.0 34-35 39.404375 41.0 40.0 41.0 37.0 41.0 36-37 39.391 41.0 40.0 41.0 37.0 41.0 38-39 39.2805 41.0 39.0 41.0 36.5 41.0 40-41 39.03575 40.5 39.0 41.0 35.5 41.0 42-43 39.08425 40.5 39.0 41.0 36.0 41.0 44-45 38.953875 40.5 38.5 41.0 35.5 41.0 46-47 39.035 41.0 39.0 41.0 35.5 41.0 48-49 38.9835 40.0 39.0 41.0 35.0 41.0 50-51 39.122625 41.0 39.0 41.0 35.5 41.0 52-53 39.150625000000005 41.0 39.0 41.0 36.0 41.0 54-55 39.089625 41.0 39.0 41.0 35.5 41.0 56-57 38.869125 41.0 39.0 41.0 35.0 41.0 58-59 38.610625 40.5 38.0 41.0 35.0 41.0 60-61 38.48224999999999 40.0 38.0 41.0 35.0 41.0 62-63 38.177375 40.0 37.0 41.0 34.5 41.0 64-65 37.87225 39.5 37.0 41.0 34.0 41.0 66-67 37.594750000000005 39.0 36.0 41.0 34.0 41.0 68-69 37.158375 38.5 35.5 40.5 33.5 41.0 70-71 36.744375 37.5 35.0 40.0 33.0 41.0 72-73 36.363375000000005 37.0 35.0 39.0 33.0 41.0 74-75 35.939499999999995 36.5 35.0 39.0 33.0 40.5 76-77 34.998125 36.0 34.5 37.0 31.5 39.0 78-79 35.09525 36.0 35.0 37.0 33.0 39.0 80-81 34.789625 35.0 35.0 37.0 32.5 39.0 82-83 34.524625 35.0 35.0 36.5 32.5 37.0 84-85 34.180875 35.0 35.0 36.0 32.0 37.0 86-87 33.990375 35.0 35.0 36.0 32.0 37.0 88-89 33.601 35.0 34.0 35.0 31.5 36.0 90-91 33.51925 35.0 34.0 35.0 31.0 36.0 92-93 33.439499999999995 35.0 34.0 35.0 31.0 36.0 94-95 33.304249999999996 35.0 34.0 35.0 31.0 36.0 96-97 33.212125 35.0 34.0 35.0 31.0 35.0 98-99 33.127 35.0 34.0 35.0 31.0 35.0 100 32.9485 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 4.0 11 2.0 12 1.0 13 2.0 14 2.0 15 4.0 16 3.0 17 6.0 18 1.0 19 4.0 20 6.0 21 6.0 22 3.0 23 7.0 24 9.0 25 8.0 26 8.0 27 14.0 28 20.0 29 20.0 30 27.0 31 41.0 32 49.0 33 68.0 34 86.0 35 164.0 36 262.0 37 810.0 38 1793.0 39 566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.224999999999998 17.549999999999997 13.600000000000001 44.625 2 19.625 23.375 37.275000000000006 19.725 3 19.925 27.3 29.475 23.3 4 23.799999999999997 30.8 23.025000000000002 22.375 5 24.256064016004 36.03400850212553 21.930482620655166 17.779444861215303 6 17.2 38.875 23.925 20.0 7 15.775 18.75 44.800000000000004 20.674999999999997 8 18.725 23.25 31.175000000000004 26.85 9 18.475 24.45 32.375 24.7 10-11 22.9625 32.9125 22.9875 21.1375 12-13 20.5875 26.224999999999998 30.3 22.8875 14-15 20.8625 28.212500000000002 29.212500000000002 21.712500000000002 16-17 22.8875 28.1375 27.250000000000004 21.725 18-19 21.475 28.487499999999997 27.6625 22.375 20-21 21.475 28.575 27.35 22.6 22-23 21.15 29.875 26.737499999999997 22.237499999999997 24-25 20.600375234521575 28.843026891807376 27.917448405253282 22.63914946841776 26-27 20.837500000000002 28.625 28.799999999999997 21.7375 28-29 21.034180543382995 28.458745461374736 27.444597470890198 23.06247652435207 30-31 21.85505069470522 28.526724245838025 28.02603579922393 21.592189260232818 32-33 21.3875 28.8375 28.050000000000004 21.725 34-35 21.15 28.749999999999996 27.800000000000004 22.3 36-37 21.4375 28.849999999999998 27.987499999999997 21.725 38-39 22.0 28.1 28.0875 21.8125 40-41 21.8625 28.212500000000002 27.35 22.575 42-43 21.712500000000002 28.1625 28.525 21.6 44-45 22.325 28.325 27.474999999999998 21.875 46-47 22.412499999999998 27.5625 28.1125 21.912499999999998 48-49 21.425 28.537499999999998 28.3625 21.675 50-51 22.5625 27.925 27.3875 22.125 52-53 22.525000000000002 28.749999999999996 27.325 21.4 54-55 21.462500000000002 28.0875 28.6375 21.8125 56-57 22.075 29.2875 26.8375 21.8 58-59 21.349999999999998 28.3375 27.462500000000002 22.85 60-61 22.2625 28.0875 28.1875 21.462500000000002 62-63 21.775 28.1875 27.975 22.0625 64-65 21.8 28.249999999999996 28.4375 21.512500000000003 66-67 22.7625 27.425 28.15 21.6625 68-69 22.25 28.15 27.6375 21.9625 70-71 22.35 28.075 27.575 22.0 72-73 21.625 28.575 28.275 21.525 74-75 22.475 27.474999999999998 27.8375 22.2125 76-77 21.3 29.062500000000004 28.175 21.462500000000002 78-79 22.6875 28.075 27.8625 21.375 80-81 22.025 27.700000000000003 27.8875 22.3875 82-83 22.6 28.125 27.625 21.65 84-85 21.725 28.237499999999997 28.487499999999997 21.55 86-87 21.725 28.6375 28.4125 21.224999999999998 88-89 22.6875 27.9125 27.8125 21.587500000000002 90-91 22.025 27.675 28.9375 21.3625 92-93 22.025 29.012500000000003 28.0625 20.9 94-95 22.0125 27.787499999999998 28.875 21.325 96-97 22.3 28.175 27.537499999999998 21.987499999999997 98-99 21.912499999999998 28.549999999999997 28.012500000000003 21.525 100 21.7 28.075 28.000000000000004 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 3.5 25 4.0 26 6.0 27 8.5 28 12.0 29 18.5 30 23.5 31 27.0 32 29.5 33 42.0 34 65.5 35 84.0 36 104.5 37 125.5 38 139.0 39 162.5 40 203.5 41 234.5 42 237.5 43 246.0 44 257.5 45 257.5 46 267.0 47 251.5 48 223.5 49 198.5 50 157.5 51 129.5 52 115.0 53 87.5 54 64.5 55 48.0 56 30.0 57 21.0 58 15.5 59 16.5 60 15.0 61 13.5 62 11.0 63 9.0 64 5.0 65 4.0 66 5.5 67 2.5 68 1.0 69 0.5 70 1.0 71 1.0 72 1.0 73 1.5 74 1.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0625 26-27 0.0 28-29 0.1625 30-31 0.13749999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451886 spots for SRR3207955.sra Written 451886 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra Read 451874 spots for SRR3207955.sra Written 451874 spots for SRR3207955.sra SRR ids: ['SRR3207955.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_purtfho1 SRR3207955.sra spots: 9037492 blocks: [[1, 451874], [451875, 903748], [903749, 1355622], [1355623, 1807496], [1807497, 2259370], [2259371, 2711244], [2711245, 3163118], [3163119, 3614992], [3614993, 4066866], [4066867, 4518740], [4518741, 4970614], [4970615, 5422488], [5422489, 5874362], [5874363, 6326236], [6326237, 6778110], [6778111, 7229984], [7229985, 7681858], [7681859, 8133732], [8133733, 8585606], [8585607, 9037492]] SRR3207955 file size 2342065 SRR3207955 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207955 SRR3207955_1.fastq Input file: SRR3207955_1.fastq trimmed: SRR3207955-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:15:48 2025 >> started Tue Feb 11 20:15:53 2025 >> done (4.568s) 9037492 reads processed; of these: 1247 ( 0.01%) short reads filtered out after trimming by size control 11742 ( 0.13%) empty reads filtered out after trimming by size control 9024503 (99.86%) reads available; of these: 397334 ( 4.40%) trimmed reads available after processing 8627169 (95.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 153 0.00% 19 222 0.00% 20 278 0.00% 21 333 0.00% 22 471 0.01% 23 663 0.01% 24 893 0.01% 25 1164 0.01% 26 1595 0.02% 27 1427 0.02% 28 1315 0.01% 29 1291 0.01% 30 1255 0.01% 31 1278 0.01% 32 1359 0.02% 33 1334 0.01% 34 1459 0.02% 35 1536 0.02% 36 1572 0.02% 37 1619 0.02% 38 1743 0.02% 39 1652 0.02% 40 1654 0.02% 41 1755 0.02% 42 1850 0.02% 43 1822 0.02% 44 1937 0.02% 45 2044 0.02% 46 2132 0.02% 47 2231 0.02% 48 2159 0.02% 49 2231 0.02% 50 2285 0.03% 51 2511 0.03% 52 2449 0.03% 53 2750 0.03% 54 3056 0.03% 55 2630 0.03% 56 2673 0.03% 57 2733 0.03% 58 2790 0.03% 59 2872 0.03% 60 2974 0.03% 61 2989 0.03% 62 3050 0.03% 63 3224 0.04% 64 3214 0.04% 65 3400 0.04% 66 3458 0.04% 67 3553 0.04% 68 3719 0.04% 69 3776 0.04% 70 3928 0.04% 71 4030 0.04% 72 4221 0.05% 73 4301 0.05% 74 4506 0.05% 75 4524 0.05% 76 3251 0.04% 77 3598 0.04% 78 4159 0.05% 79 4375 0.05% 80 4749 0.05% 81 5016 0.06% 82 5333 0.06% 83 5861 0.06% 84 6110 0.07% 85 6513 0.07% 86 6763 0.07% 87 7322 0.08% 88 8165 0.09% 89 8794 0.10% 90 9443 0.10% 91 10784 0.12% 92 11976 0.13% 93 13589 0.15% 94 15978 0.18% 95 18623 0.21% 96 21544 0.24% 97 25623 0.28% 98 29409 0.33% 99 30313 0.34% 100 8627169 95.60% 9024503 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.63 fanout-score-rank=16 prefix-density=0.04 prefix-fanout=5.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=188.11 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=25.0 sequence=AAGAAGAAGAAA Started job on | Feb 11 20:16:11 Started mapping on | Feb 11 20:16:11 Finished on | Feb 11 20:16:24 Mapping speed, Million of reads per hour | 2499.09 Number of input reads | 9024503 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8473376 Uniquely mapped reads % | 93.89% Average mapped length | 98.93 Number of splices: Total | 2401926 Number of splices: Annotated (sjdb) | 2356110 Number of splices: GT/AG | 2366177 Number of splices: GC/AG | 29138 Number of splices: AT/AC | 2731 Number of splices: Non-canonical | 3880 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197263 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 28191 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 353864 353864 353864 N_multimapping 197263 197263 197263 N_noFeature 389035 4382785 4412921 N_ambiguous 96470 14932 14958 UnstrandedReadsAssigned:7987871 PositiveStrandReadsAssigned:4075659 NegativeStrandReadsAssigned:4045497 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207955 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207955-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,024,503 reads, 8,186,066 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR3207955.ke.tsv 34699 SRR3207955.se.tsv 87100 total ==> SRR3207955.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 448 42.1922 Potri.005G024800.1.v4.1 1035 936 68 13.1299 Potri.004G059700.1.v4.1 961 862 33 6.91888 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 138.056 8.77312 Potri.016G087400.1.v4.1 270 171 319 337.151 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16 1.7274 Potri.012G127500.1.v4.1 977 878 577 118.771 ==> SRR3207955.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1055 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207955 completed mapping pipeline successfully