Starting /dee2/code/volunteer_pipeline.sh SRR3207956 current disk space = 3052818214912 free memory = 1477172916 SRR3207956 SRAfilesize 021a08b0cee5a29519eb68af53d95d56 SRR3207956.sra SRR3207956.sra file validated SRR3207956 is single end SRR3207956 is conventional basespace SRR3207956 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207956_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1985 34.0 33.0 34.0 31.0 34.0 2 33.315 34.0 34.0 34.0 31.0 34.0 3 33.336 34.0 34.0 34.0 31.0 34.0 4 36.38925 37.0 37.0 37.0 35.0 37.0 5 36.46525 37.0 37.0 37.0 35.0 37.0 6 36.478 37.0 37.0 37.0 35.0 37.0 7 36.4295 37.0 37.0 37.0 35.0 37.0 8 36.504 37.0 37.0 37.0 35.0 37.0 9 38.39575 39.0 39.0 39.0 37.0 39.0 10-11 38.348749999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.335625 39.0 39.0 39.0 37.0 39.0 14-15 39.9945 41.0 40.0 41.0 38.0 41.0 16-17 40.008375 41.0 40.0 41.0 38.0 41.0 18-19 39.997749999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.8915 41.0 40.0 41.0 38.0 41.0 22-23 39.859 41.0 40.0 41.0 38.0 41.0 24-25 39.80225 41.0 40.0 41.0 38.0 41.0 26-27 39.723 41.0 40.0 41.0 38.0 41.0 28-29 39.579 41.0 40.0 41.0 37.5 41.0 30-31 39.358000000000004 41.0 40.0 41.0 37.0 41.0 32-33 39.463625 41.0 40.0 41.0 37.0 41.0 34-35 39.2775 41.0 40.0 41.0 37.0 41.0 36-37 39.273375 41.0 39.0 41.0 36.0 41.0 38-39 39.105125 41.0 39.0 41.0 36.0 41.0 40-41 38.8735 40.5 39.0 41.0 35.5 41.0 42-43 38.90675 40.5 39.0 41.0 35.0 41.0 44-45 38.8305 40.5 39.0 41.0 35.5 41.0 46-47 38.873000000000005 40.5 39.0 41.0 35.0 41.0 48-49 38.806625 41.0 39.0 41.0 35.0 41.0 50-51 38.860625 41.0 39.0 41.0 35.0 41.0 52-53 38.945499999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.869875 41.0 39.0 41.0 35.0 41.0 56-57 38.63125 41.0 38.5 41.0 35.0 41.0 58-59 38.494749999999996 40.5 38.0 41.0 35.0 41.0 60-61 38.278999999999996 40.0 37.5 41.0 34.5 41.0 62-63 38.013625000000005 40.0 37.0 41.0 34.0 41.0 64-65 37.624875 39.0 36.0 41.0 33.5 41.0 66-67 37.3815 39.0 36.0 41.0 33.5 41.0 68-69 36.953625 38.5 35.5 41.0 33.5 41.0 70-71 36.505250000000004 37.5 35.0 40.0 33.0 41.0 72-73 36.124625 37.0 35.0 39.0 33.0 41.0 74-75 35.6455 36.5 35.0 39.0 32.0 40.5 76-77 34.667625 36.0 34.0 37.0 30.5 39.0 78-79 34.795249999999996 36.0 35.0 37.0 32.0 39.0 80-81 34.495374999999996 35.0 35.0 37.0 32.0 39.0 82-83 34.2185 35.0 35.0 36.0 31.5 37.0 84-85 33.967625 35.0 35.0 36.0 31.0 37.0 86-87 33.711749999999995 35.0 35.0 36.0 31.0 37.0 88-89 33.407375 35.0 34.0 35.0 30.5 36.0 90-91 33.25925 35.0 34.0 35.0 30.5 36.0 92-93 33.154125 35.0 34.0 35.0 31.0 36.0 94-95 33.080875 35.0 34.0 35.0 31.0 36.0 96-97 32.907 35.0 34.0 35.0 30.5 35.5 98-99 32.732875 35.0 34.0 35.0 30.0 35.0 100 32.62975 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 2.0 10 3.0 11 7.0 12 2.0 13 2.0 14 6.0 15 4.0 16 2.0 17 3.0 18 4.0 19 8.0 20 1.0 21 6.0 22 7.0 23 5.0 24 6.0 25 13.0 26 21.0 27 22.0 28 19.0 29 34.0 30 36.0 31 38.0 32 61.0 33 65.0 34 91.0 35 165.0 36 273.0 37 742.0 38 1746.0 39 603.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.599999999999998 16.7 12.825000000000001 46.875 2 18.95 25.174999999999997 37.35 18.525 3 20.7 26.775 28.025 24.5 4 24.125 32.35 20.549999999999997 22.975 5 23.80595148787197 35.183795948987246 22.53063265816454 18.479619904976243 6 18.45 37.475 24.474999999999998 19.6 7 16.925 18.625 43.974999999999994 20.474999999999998 8 19.125 24.15 31.15 25.575 9 20.625 21.775 33.75 23.849999999999998 10-11 22.6 33.3375 23.75 20.3125 12-13 19.787499999999998 27.150000000000002 30.025000000000002 23.0375 14-15 20.837500000000002 28.499999999999996 27.712500000000002 22.95 16-17 22.275 28.499999999999996 27.250000000000004 21.975 18-19 20.9 28.525 27.5875 22.9875 20-21 21.425 29.025000000000002 27.700000000000003 21.85 22-23 21.837500000000002 29.2375 26.575 22.35 24-25 21.463414634146343 28.430268918073796 27.70481550969356 22.401500938086304 26-27 22.025 28.212500000000002 27.875 21.8875 28-29 21.341845036925772 29.06496432594818 27.312554762798847 22.2806358743272 30-31 20.931980458474257 28.94901666040336 27.195289991231363 22.923712889891018 32-33 21.85 28.1625 27.6875 22.3 34-35 22.0 27.500000000000004 28.0875 22.412499999999998 36-37 21.725 28.6875 28.15 21.4375 38-39 22.2 28.0875 27.775 21.9375 40-41 22.125 29.4875 26.950000000000003 21.4375 42-43 21.65 27.975 27.975 22.400000000000002 44-45 22.675 27.325 28.125 21.875 46-47 21.2625 27.6125 28.812500000000004 22.3125 48-49 21.725 28.525 27.875 21.875 50-51 22.3 27.625 28.0875 21.987499999999997 52-53 22.025 28.499999999999996 27.775 21.7 54-55 20.8125 28.9125 27.9125 22.3625 56-57 21.7 28.449999999999996 28.1 21.75 58-59 22.0 29.049999999999997 27.875 21.075 60-61 21.9 27.9375 28.15 22.0125 62-63 22.15 28.050000000000004 28.512500000000003 21.2875 64-65 22.0125 28.875 27.962500000000002 21.15 66-67 21.125 28.512500000000003 27.825 22.537499999999998 68-69 21.5375 28.8625 28.1375 21.462500000000002 70-71 21.725 28.012500000000003 27.4125 22.85 72-73 22.0625 28.000000000000004 27.55 22.3875 74-75 21.837500000000002 29.375 27.650000000000002 21.1375 76-77 21.3875 29.262500000000003 28.325 21.025 78-79 21.875 28.325 27.437499999999996 22.3625 80-81 21.512500000000003 27.987499999999997 28.3375 22.162499999999998 82-83 21.8625 29.225 27.525 21.3875 84-85 22.2625 28.225 26.950000000000003 22.5625 86-87 22.325 28.787499999999998 27.650000000000002 21.2375 88-89 21.45 28.4375 27.85 22.2625 90-91 22.3125 27.700000000000003 27.675 22.3125 92-93 21.987499999999997 28.1 27.875 22.037499999999998 94-95 21.1625 28.4 28.262500000000003 22.175 96-97 22.237499999999997 28.275 27.625 21.8625 98-99 21.5375 28.487499999999997 27.8375 22.1375 100 21.55 29.525000000000002 27.700000000000003 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 3.5 26 5.0 27 7.5 28 13.0 29 15.5 30 22.0 31 31.5 32 39.5 33 51.0 34 62.5 35 77.0 36 101.0 37 122.0 38 144.5 39 173.0 40 203.5 41 222.0 42 234.5 43 260.5 44 269.0 45 261.0 46 251.5 47 237.5 48 216.0 49 187.5 50 155.0 51 129.0 52 107.0 53 84.0 54 69.0 55 54.0 56 43.5 57 34.5 58 23.0 59 16.0 60 8.5 61 6.5 62 8.0 63 8.0 64 8.5 65 6.5 66 4.5 67 4.0 68 3.5 69 3.0 70 1.5 71 1.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0625 26-27 0.0 28-29 0.13749999999999998 30-31 0.21250000000000002 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82412060301507 99.325 2 0.12562814070351758 0.25 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02512562814070352 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 13 0.325 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra Read 606402 spots for SRR3207956.sra Written 606402 spots for SRR3207956.sra Read 606399 spots for SRR3207956.sra Written 606399 spots for SRR3207956.sra SRR ids: ['SRR3207956.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7fqom7hm SRR3207956.sra spots: 12127983 blocks: [[1, 606399], [606400, 1212798], [1212799, 1819197], [1819198, 2425596], [2425597, 3031995], [3031996, 3638394], [3638395, 4244793], [4244794, 4851192], [4851193, 5457591], [5457592, 6063990], [6063991, 6670389], [6670390, 7276788], [7276789, 7883187], [7883188, 8489586], [8489587, 9095985], [9095986, 9702384], [9702385, 10308783], [10308784, 10915182], [10915183, 11521581], [11521582, 12127983]] SRR3207956 file size 3145411 SRR3207956 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207956 SRR3207956_1.fastq Input file: SRR3207956_1.fastq trimmed: SRR3207956-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:42:34 2025 >> started Tue Feb 11 20:42:40 2025 >> done (6.375s) 12127983 reads processed; of these: 2652 ( 0.02%) short reads filtered out after trimming by size control 45236 ( 0.37%) empty reads filtered out after trimming by size control 12080095 (99.61%) reads available; of these: 549375 ( 4.55%) trimmed reads available after processing 11530720 (95.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 341 0.00% 19 386 0.00% 20 3389 0.03% 21 585 0.00% 22 717 0.01% 23 1041 0.01% 24 1419 0.01% 25 1634 0.01% 26 2399 0.02% 27 1965 0.02% 28 1917 0.02% 29 1902 0.02% 30 1795 0.01% 31 1876 0.02% 32 1945 0.02% 33 1943 0.02% 34 2006 0.02% 35 2129 0.02% 36 2266 0.02% 37 2084 0.02% 38 2343 0.02% 39 2235 0.02% 40 2372 0.02% 41 2480 0.02% 42 2596 0.02% 43 2706 0.02% 44 2735 0.02% 45 2878 0.02% 46 2986 0.02% 47 2937 0.02% 48 2979 0.02% 49 3119 0.03% 50 3176 0.03% 51 3418 0.03% 52 3464 0.03% 53 3716 0.03% 54 4136 0.03% 55 3393 0.03% 56 3647 0.03% 57 3919 0.03% 58 3792 0.03% 59 3968 0.03% 60 4011 0.03% 61 4183 0.03% 62 4422 0.04% 63 5479 0.05% 64 4436 0.04% 65 4730 0.04% 66 4826 0.04% 67 5269 0.04% 68 5317 0.04% 69 5398 0.04% 70 5453 0.05% 71 5522 0.05% 72 5822 0.05% 73 5899 0.05% 74 6025 0.05% 75 6085 0.05% 76 4501 0.04% 77 4948 0.04% 78 5645 0.05% 79 6015 0.05% 80 6709 0.06% 81 7000 0.06% 82 7392 0.06% 83 7977 0.07% 84 8380 0.07% 85 8805 0.07% 86 9167 0.08% 87 10215 0.08% 88 11015 0.09% 89 12871 0.11% 90 13756 0.11% 91 14515 0.12% 92 15821 0.13% 93 18310 0.15% 94 21427 0.18% 95 24809 0.21% 96 29439 0.24% 97 34690 0.29% 98 39825 0.33% 99 40532 0.34% 100 11530720 95.45% 12080095 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=9.43 fanout-score-rank=16 prefix-density=0.06 prefix-fanout=9.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAGAAGAGCACAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=258.03 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=27.0 sequence=TTCTTCTTCTTTT Started job on | Feb 11 20:42:57 Started mapping on | Feb 11 20:42:57 Finished on | Feb 11 20:43:17 Mapping speed, Million of reads per hour | 2174.42 Number of input reads | 12080095 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11161691 Uniquely mapped reads % | 92.40% Average mapped length | 98.92 Number of splices: Total | 3113425 Number of splices: Annotated (sjdb) | 3051932 Number of splices: GT/AG | 3065943 Number of splices: GC/AG | 38596 Number of splices: AT/AC | 3642 Number of splices: Non-canonical | 5244 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266078 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 65373 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.85% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 652326 652326 652326 N_multimapping 266078 266078 266078 N_noFeature 541665 5787528 5830679 N_ambiguous 125901 20376 20534 UnstrandedReadsAssigned:10494125 PositiveStrandReadsAssigned:5353787 NegativeStrandReadsAssigned:5310478 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207956 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207956-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,080,095 reads, 10,774,218 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR3207956.ke.tsv 34699 SRR3207956.se.tsv 87100 total ==> SRR3207956.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 678 48.3116 Potri.005G024800.1.v4.1 1035 936 157 22.9361 Potri.004G059700.1.v4.1 961 862 39 6.18662 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 176.06 8.46501 Potri.016G087400.1.v4.1 270 171 381 304.667 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27 2.20549 Potri.012G127500.1.v4.1 977 878 804 125.215 ==> SRR3207956.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1401 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207956 completed mapping pipeline successfully