Starting /dee2/code/volunteer_pipeline.sh SRR3207957 current disk space = 3052994207744 free memory = 1579880140 SRR3207957 SRAfilesize 830ff298333cc2bf35af9e3ed234468b SRR3207957.sra SRR3207957.sra file validated SRR3207957 is single end SRR3207957 is conventional basespace SRR3207957 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207957_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16475 34.0 33.0 34.0 31.0 34.0 2 33.33575 34.0 34.0 34.0 31.0 34.0 3 33.3325 34.0 34.0 34.0 31.0 34.0 4 36.4055 37.0 37.0 37.0 35.0 37.0 5 36.49375 37.0 37.0 37.0 35.0 37.0 6 36.52525 37.0 37.0 37.0 35.0 37.0 7 36.443 37.0 37.0 37.0 35.0 37.0 8 36.528 37.0 37.0 37.0 35.0 37.0 9 38.40775 39.0 39.0 39.0 37.0 39.0 10-11 38.40412499999999 39.0 39.0 39.0 37.0 39.0 12-13 38.34375 39.0 39.0 39.0 37.0 39.0 14-15 40.009125 41.0 40.0 41.0 38.0 41.0 16-17 40.028875 41.0 40.0 41.0 38.0 41.0 18-19 40.017875000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.97625 41.0 40.0 41.0 38.0 41.0 22-23 39.91475 41.0 40.0 41.0 38.0 41.0 24-25 39.855125 41.0 40.0 41.0 38.0 41.0 26-27 39.84675 41.0 40.0 41.0 38.0 41.0 28-29 39.6665 41.0 40.0 41.0 37.5 41.0 30-31 39.374 41.0 40.0 41.0 37.0 41.0 32-33 39.515 41.0 40.0 41.0 37.0 41.0 34-35 39.414375 41.0 40.0 41.0 37.0 41.0 36-37 39.344750000000005 41.0 39.5 41.0 37.0 41.0 38-39 39.27875 41.0 39.0 41.0 36.5 41.0 40-41 39.02612499999999 40.5 39.0 41.0 35.5 41.0 42-43 39.012 40.5 39.0 41.0 35.0 41.0 44-45 38.966 40.5 39.0 41.0 35.5 41.0 46-47 39.09375 41.0 39.0 41.0 35.5 41.0 48-49 38.9645 40.5 39.0 41.0 35.0 41.0 50-51 39.12325 41.0 39.0 41.0 36.0 41.0 52-53 39.148875000000004 41.0 39.0 41.0 36.0 41.0 54-55 39.11225 41.0 39.0 41.0 35.5 41.0 56-57 38.93475 41.0 39.0 41.0 35.0 41.0 58-59 38.7795 41.0 38.5 41.0 35.0 41.0 60-61 38.65075 40.0 38.0 41.0 35.0 41.0 62-63 38.251625000000004 40.0 37.0 41.0 34.5 41.0 64-65 38.00375 39.5 37.0 41.0 34.0 41.0 66-67 37.684875 39.0 36.0 41.0 34.0 41.0 68-69 37.170249999999996 38.5 35.5 40.5 33.5 41.0 70-71 36.810125 37.5 35.0 40.0 33.5 41.0 72-73 36.494375 37.0 35.0 39.0 33.5 41.0 74-75 35.982625 36.5 35.0 39.0 33.0 40.5 76-77 35.04175 36.0 34.5 37.0 31.5 39.0 78-79 35.158625 36.0 35.0 37.0 33.0 39.0 80-81 34.86825 35.0 35.0 37.0 33.0 39.0 82-83 34.568375 35.0 35.0 36.0 32.5 37.0 84-85 34.279125 35.0 35.0 36.0 32.0 37.0 86-87 34.052375 35.0 35.0 36.0 32.0 36.5 88-89 33.659125 35.0 34.0 35.0 31.5 36.0 90-91 33.561375 35.0 34.0 35.0 31.0 36.0 92-93 33.482124999999996 35.0 34.0 35.0 31.0 36.0 94-95 33.36725 35.0 34.0 35.0 31.0 36.0 96-97 33.188 35.0 34.0 35.0 31.0 35.0 98-99 33.039625 35.0 34.0 35.0 31.0 35.0 100 32.84225 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 4.0 12 4.0 13 2.0 14 2.0 15 3.0 16 3.0 17 3.0 18 1.0 19 2.0 20 6.0 21 3.0 22 1.0 23 5.0 24 7.0 25 8.0 26 9.0 27 13.0 28 24.0 29 26.0 30 27.0 31 49.0 32 38.0 33 83.0 34 87.0 35 156.0 36 268.0 37 762.0 38 1834.0 39 564.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.7 16.475 12.6 47.225 2 20.45 22.375 38.550000000000004 18.625 3 20.95 26.174999999999997 27.725 25.15 4 23.474999999999998 32.375 20.25 23.9 5 23.200000000000003 35.75 22.775000000000002 18.275 6 18.65 36.975 24.474999999999998 19.900000000000002 7 17.525 18.4 43.75 20.325 8 18.025 22.900000000000002 31.324999999999996 27.750000000000004 9 19.575 23.799999999999997 33.15 23.474999999999998 10-11 22.1375 33.025 23.425 21.4125 12-13 20.95 26.525 29.8875 22.6375 14-15 20.275000000000002 27.962500000000002 28.8375 22.925 16-17 21.6125 28.199999999999996 27.575 22.6125 18-19 21.712500000000002 28.462500000000002 27.575 22.25 20-21 21.8625 28.237499999999997 28.050000000000004 21.85 22-23 22.175 28.725 26.987499999999997 22.112499999999997 24-25 19.81981981981982 29.37937937937938 27.515015015015017 23.285785785785787 26-27 22.25 28.299999999999997 27.212500000000002 22.237499999999997 28-29 21.758737316798197 27.771514468245023 27.959413754227736 22.510334460729048 30-31 22.380952380952383 28.345864661654137 27.205513784461154 22.06766917293233 32-33 22.0875 28.225 27.762500000000003 21.925 34-35 22.3 28.5875 27.3625 21.75 36-37 21.45 28.7375 27.4125 22.400000000000002 38-39 22.1 28.849999999999998 27.3375 21.712500000000002 40-41 22.412499999999998 27.825 27.700000000000003 22.0625 42-43 22.275 27.775 27.9375 22.0125 44-45 21.5375 27.787499999999998 28.287499999999998 22.3875 46-47 21.15 27.3625 28.65 22.8375 48-49 21.0 28.212500000000002 28.15 22.6375 50-51 21.9 28.512500000000003 28.5625 21.025 52-53 21.8125 28.0875 28.1 22.0 54-55 21.0125 27.875 28.625 22.4875 56-57 22.5 27.950000000000003 28.1375 21.4125 58-59 21.212500000000002 29.3375 27.462500000000002 21.987499999999997 60-61 21.462500000000002 28.849999999999998 27.125 22.5625 62-63 21.8875 27.8375 29.012500000000003 21.2625 64-65 22.125 28.237499999999997 28.487499999999997 21.15 66-67 22.2 28.037499999999998 27.762500000000003 22.0 68-69 22.575 29.0875 26.8125 21.525 70-71 21.762500000000003 28.275 27.85 22.112499999999997 72-73 22.0 27.5875 27.85 22.5625 74-75 21.0125 28.849999999999998 28.0875 22.05 76-77 22.225 28.275 28.5875 20.9125 78-79 22.0 28.1 27.750000000000004 22.15 80-81 22.1375 27.6625 28.249999999999996 21.95 82-83 21.587500000000002 28.487499999999997 27.950000000000003 21.975 84-85 21.6125 27.6 28.1125 22.675 86-87 22.15 28.4125 28.249999999999996 21.1875 88-89 22.25 27.8875 27.6125 22.25 90-91 22.037499999999998 27.6625 27.8875 22.412499999999998 92-93 21.587500000000002 28.712500000000002 27.9125 21.7875 94-95 21.5375 27.900000000000002 28.487499999999997 22.075 96-97 21.4125 28.249999999999996 28.4125 21.925 98-99 21.55 28.0875 29.037499999999998 21.325 100 23.525 27.450000000000003 27.775 21.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.0 25 2.5 26 3.0 27 7.0 28 11.5 29 13.5 30 19.0 31 23.5 32 35.0 33 49.0 34 60.0 35 80.5 36 100.0 37 111.0 38 127.5 39 172.5 40 210.0 41 222.5 42 235.0 43 246.0 44 268.0 45 269.0 46 274.0 47 275.5 48 236.0 49 194.0 50 150.5 51 121.5 52 102.0 53 86.0 54 68.5 55 45.5 56 32.0 57 29.5 58 28.0 59 17.5 60 13.5 61 10.5 62 6.0 63 4.5 64 4.0 65 4.5 66 4.5 67 4.0 68 3.5 69 4.5 70 4.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.1 26-27 0.0 28-29 0.21250000000000002 30-31 0.25 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736923 spots for SRR3207957.sra Written 736923 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra Read 736916 spots for SRR3207957.sra Written 736916 spots for SRR3207957.sra SRR ids: ['SRR3207957.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_in_dgty7 SRR3207957.sra spots: 14738327 blocks: [[1, 736916], [736917, 1473832], [1473833, 2210748], [2210749, 2947664], [2947665, 3684580], [3684581, 4421496], [4421497, 5158412], [5158413, 5895328], [5895329, 6632244], [6632245, 7369160], [7369161, 8106076], [8106077, 8842992], [8842993, 9579908], [9579909, 10316824], [10316825, 11053740], [11053741, 11790656], [11790657, 12527572], [12527573, 13264488], [13264489, 14001404], [14001405, 14738327]] SRR3207957 file size 3824736 SRR3207957 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207957 SRR3207957_1.fastq Input file: SRR3207957_1.fastq trimmed: SRR3207957-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:12:08 2025 >> started Tue Feb 11 21:12:15 2025 >> done (7.170s) 14738327 reads processed; of these: 2363 ( 0.02%) short reads filtered out after trimming by size control 36190 ( 0.25%) empty reads filtered out after trimming by size control 14699774 (99.74%) reads available; of these: 643507 ( 4.38%) trimmed reads available after processing 14056267 (95.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 298 0.00% 19 354 0.00% 20 442 0.00% 21 562 0.00% 22 783 0.01% 23 1058 0.01% 24 1449 0.01% 25 1945 0.01% 26 2593 0.02% 27 2419 0.02% 28 2071 0.01% 29 2147 0.01% 30 2007 0.01% 31 2108 0.01% 32 2242 0.02% 33 2217 0.02% 34 2391 0.02% 35 2404 0.02% 36 2559 0.02% 37 2536 0.02% 38 2709 0.02% 39 2718 0.02% 40 2688 0.02% 41 2797 0.02% 42 3005 0.02% 43 3103 0.02% 44 3104 0.02% 45 3313 0.02% 46 3376 0.02% 47 3401 0.02% 48 3456 0.02% 49 3695 0.03% 50 3622 0.02% 51 3920 0.03% 52 4052 0.03% 53 4473 0.03% 54 4906 0.03% 55 4069 0.03% 56 4291 0.03% 57 4394 0.03% 58 4505 0.03% 59 4497 0.03% 60 4675 0.03% 61 4857 0.03% 62 4872 0.03% 63 5168 0.04% 64 5109 0.03% 65 5420 0.04% 66 5611 0.04% 67 5808 0.04% 68 6165 0.04% 69 6266 0.04% 70 6299 0.04% 71 6695 0.05% 72 6682 0.05% 73 7081 0.05% 74 7168 0.05% 75 7427 0.05% 76 5396 0.04% 77 5848 0.04% 78 6685 0.05% 79 7273 0.05% 80 7886 0.05% 81 8304 0.06% 82 8773 0.06% 83 9473 0.06% 84 9802 0.07% 85 10457 0.07% 86 10975 0.07% 87 11838 0.08% 88 12905 0.09% 89 14024 0.10% 90 15397 0.10% 91 17108 0.12% 92 19276 0.13% 93 22352 0.15% 94 25825 0.18% 95 30205 0.21% 96 35503 0.24% 97 41934 0.29% 98 47504 0.32% 99 48782 0.33% 100 14056267 95.62% 14699774 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.83 fanout-score-rank=18 prefix-density=0.03 prefix-fanout=5.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=283.45 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 21:12:33 Started mapping on | Feb 11 21:12:33 Finished on | Feb 11 21:12:54 Mapping speed, Million of reads per hour | 2519.96 Number of input reads | 14699774 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13668240 Uniquely mapped reads % | 92.98% Average mapped length | 98.95 Number of splices: Total | 3893608 Number of splices: Annotated (sjdb) | 3817350 Number of splices: GT/AG | 3834030 Number of splices: GC/AG | 48840 Number of splices: AT/AC | 4366 Number of splices: Non-canonical | 6372 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321646 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 114398 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 709888 709888 709888 N_multimapping 321646 321646 321646 N_noFeature 648032 7080830 7135708 N_ambiguous 148309 24292 24494 UnstrandedReadsAssigned:12871899 PositiveStrandReadsAssigned:6563118 NegativeStrandReadsAssigned:6508038 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207957 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207957-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,699,774 reads, 13,234,733 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR3207957.ke.tsv 34699 SRR3207957.se.tsv 87100 total ==> SRR3207957.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 853 49.7701 Potri.005G024800.1.v4.1 1035 936 205.023 24.5256 Potri.004G059700.1.v4.1 961 862 66 8.57297 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 212.219 8.35505 Potri.016G087400.1.v4.1 270 171 418 273.7 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 30 2.0066 Potri.012G127500.1.v4.1 977 878 1334 170.12 ==> SRR3207957.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1499 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 56 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207957 completed mapping pipeline successfully