Starting /dee2/code/volunteer_pipeline.sh SRR3207958 current disk space = 3052912271360 free memory = 1574849996 SRR3207958 SRAfilesize 9fd0ce6aa309c542deb30c74362a9912 SRR3207958.sra SRR3207958.sra file validated SRR3207958 is single end SRR3207958 is conventional basespace SRR3207958 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207958_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13475 34.0 33.0 34.0 31.0 34.0 2 33.29725 34.0 34.0 34.0 31.0 34.0 3 33.35675 34.0 34.0 34.0 31.0 34.0 4 36.59375 37.0 37.0 37.0 35.0 37.0 5 36.547 37.0 37.0 37.0 35.0 37.0 6 36.35025 37.0 37.0 37.0 35.0 37.0 7 36.48275 37.0 37.0 37.0 35.0 37.0 8 36.379 37.0 37.0 37.0 35.0 37.0 9 38.23625 39.0 39.0 39.0 37.0 39.0 10-11 38.293625 39.0 39.0 39.0 37.0 39.0 12-13 38.422875 39.0 39.0 39.0 37.0 39.0 14-15 40.075625 41.0 40.0 41.0 38.0 41.0 16-17 39.947625 41.0 40.0 41.0 38.0 41.0 18-19 39.884875 41.0 40.0 41.0 38.0 41.0 20-21 39.985375000000005 41.0 40.0 41.0 38.0 41.0 22-23 39.806875 41.0 40.0 41.0 38.0 41.0 24-25 39.860875 41.0 40.0 41.0 38.0 41.0 26-27 39.883250000000004 41.0 40.0 41.0 38.0 41.0 28-29 39.831625 41.0 40.0 41.0 38.0 41.0 30-31 39.73125 41.0 40.0 41.0 38.0 41.0 32-33 39.5745 41.0 40.0 41.0 37.0 41.0 34-35 39.597 41.0 40.0 41.0 37.5 41.0 36-37 39.490875 41.0 40.0 41.0 37.0 41.0 38-39 39.4695 41.0 40.0 41.0 37.0 41.0 40-41 39.3585 41.0 39.5 41.0 37.0 41.0 42-43 39.236999999999995 41.0 40.0 41.0 36.5 41.0 44-45 39.22 41.0 39.0 41.0 36.0 41.0 46-47 39.204499999999996 41.0 39.0 41.0 36.0 41.0 48-49 39.15575 41.0 39.0 41.0 36.0 41.0 50-51 39.280125 41.0 39.0 41.0 37.0 41.0 52-53 39.363125 41.0 40.0 41.0 36.5 41.0 54-55 39.204750000000004 41.0 39.0 41.0 36.0 41.0 56-57 38.73525 41.0 38.5 41.0 34.5 41.0 58-59 38.893874999999994 41.0 39.0 41.0 35.0 41.0 60-61 38.71975 40.5 38.0 41.0 35.0 41.0 62-63 38.5865 40.0 37.5 41.0 35.0 41.0 64-65 38.271 40.0 37.0 41.0 35.0 41.0 66-67 37.837125 39.0 36.5 41.0 34.5 41.0 68-69 37.522875 39.0 36.0 41.0 34.0 41.0 70-71 36.965625 38.5 35.5 40.5 34.0 41.0 72-73 36.348 37.0 35.0 39.0 33.5 41.0 74-75 35.95025 37.0 35.0 39.0 33.0 41.0 76-77 34.93625 36.0 34.5 37.5 31.5 39.0 78-79 35.034125 36.0 35.0 37.0 32.5 39.0 80-81 34.825625 35.0 35.0 37.0 33.0 39.0 82-83 34.569125 35.0 35.0 36.5 33.0 37.0 84-85 34.252875 35.0 35.0 36.0 33.0 37.0 86-87 34.054874999999996 35.0 35.0 36.0 32.5 37.0 88-89 33.848124999999996 35.0 35.0 35.0 32.0 36.0 90-91 33.630625 35.0 35.0 35.0 32.0 36.0 92-93 33.533500000000004 35.0 35.0 35.0 32.0 36.0 94-95 33.502375 35.0 35.0 35.0 32.0 36.0 96-97 33.39675 35.0 35.0 35.0 32.0 36.0 98-99 33.19475 35.0 34.5 35.0 32.0 35.0 100 33.02025 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 4.0 13 4.0 14 4.0 15 0.0 16 2.0 17 1.0 18 0.0 19 4.0 20 3.0 21 3.0 22 3.0 23 3.0 24 9.0 25 6.0 26 16.0 27 36.0 28 17.0 29 15.0 30 26.0 31 29.0 32 39.0 33 74.0 34 66.0 35 149.0 36 246.0 37 755.0 38 1829.0 39 648.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.55 16.650000000000002 15.55 43.25 2 19.0 24.0 38.875 18.125 3 20.925 27.500000000000004 29.099999999999998 22.475 4 22.400000000000002 33.25 21.65 22.7 5 23.875 34.675 22.525000000000002 18.925 6 18.45 37.325 25.025 19.2 7 16.875 18.45 44.75 19.925 8 18.099999999999998 23.525 30.7 27.675 9 21.025 22.75 32.775 23.45 10-11 22.3125 33.287499999999994 22.875 21.525 12-13 19.8375 27.125 29.037499999999998 24.0 14-15 20.7625 28.000000000000004 28.499999999999996 22.7375 16-17 21.25 28.1875 28.299999999999997 22.2625 18-19 21.4 27.9125 27.250000000000004 23.4375 20-21 21.587500000000002 27.775 29.037499999999998 21.6 22-23 22.3375 28.825 27.725 21.1125 24-25 20.30761535575841 29.3985244466675 28.123046142303366 22.170814055270725 26-27 21.375 27.987499999999997 27.525 23.1125 28-29 21.42142142142142 28.87887887887888 27.565065065065063 22.134634634634633 30-31 21.339173967459324 27.797246558197745 28.898623279098874 21.964956195244056 32-33 20.474999999999998 29.762499999999996 27.737499999999997 22.025 34-35 21.8 28.449999999999996 27.800000000000004 21.95 36-37 21.5625 27.175 27.787499999999998 23.474999999999998 38-39 21.25 28.675 28.225 21.85 40-41 21.2875 28.825 29.0875 20.8 42-43 21.2375 28.3375 27.575 22.85 44-45 21.2375 28.175 27.962500000000002 22.625 46-47 21.475 29.025000000000002 27.800000000000004 21.7 48-49 21.725 27.625 28.675 21.975 50-51 21.1125 28.1125 28.9125 21.8625 52-53 22.05 27.8375 28.275 21.837500000000002 54-55 21.825 28.262500000000003 27.425 22.4875 56-57 21.375 27.8125 29.012500000000003 21.8 58-59 23.1125 27.712500000000002 28.725 20.45 60-61 21.087500000000002 28.3875 28.6875 21.837500000000002 62-63 21.5625 28.237499999999997 29.262500000000003 20.9375 64-65 21.3625 28.962500000000002 28.3625 21.3125 66-67 22.025 28.749999999999996 27.775 21.45 68-69 21.275 29.3875 28.225 21.1125 70-71 22.15 28.749999999999996 27.0 22.1 72-73 21.25 29.049999999999997 27.775 21.925 74-75 21.2625 29.0875 27.8625 21.7875 76-77 22.975 28.675 27.962500000000002 20.3875 78-79 21.9 27.825 28.5625 21.712500000000002 80-81 20.962500000000002 28.8625 29.037499999999998 21.1375 82-83 22.162499999999998 28.849999999999998 28.15 20.837500000000002 84-85 21.3125 27.800000000000004 28.4 22.4875 86-87 22.412499999999998 27.700000000000003 28.762500000000003 21.125 88-89 22.025 28.225 28.849999999999998 20.9 90-91 22.2625 28.075 27.500000000000004 22.162499999999998 92-93 21.0125 28.3875 28.749999999999996 21.85 94-95 21.6 28.275 27.800000000000004 22.325 96-97 21.5 29.012500000000003 27.975 21.512500000000003 98-99 21.8625 29.212500000000002 27.1375 21.7875 100 22.125 28.425 28.625 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.5 25 3.0 26 4.0 27 8.0 28 13.0 29 15.5 30 24.0 31 34.5 32 42.5 33 54.5 34 63.0 35 74.5 36 105.5 37 131.0 38 138.5 39 156.0 40 189.0 41 238.0 42 260.0 43 263.5 44 278.5 45 283.5 46 270.0 47 238.5 48 214.0 49 195.0 50 152.0 51 117.5 52 99.5 53 83.0 54 69.0 55 46.5 56 32.5 57 22.0 58 14.0 59 14.5 60 12.0 61 7.5 62 5.0 63 3.5 64 1.5 65 1.5 66 2.0 67 1.5 68 2.0 69 2.5 70 2.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.1 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69696969696969 98.7 2 0.25252525252525254 0.5 3 0.0 0.0 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025252525252525252 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 28 0.7000000000000001 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.1875 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.3125 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.35 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791722 spots for SRR3207958.sra Written 791722 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra Read 791707 spots for SRR3207958.sra Written 791707 spots for SRR3207958.sra SRR ids: ['SRR3207958.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qzqptydb SRR3207958.sra spots: 15834155 blocks: [[1, 791707], [791708, 1583414], [1583415, 2375121], [2375122, 3166828], [3166829, 3958535], [3958536, 4750242], [4750243, 5541949], [5541950, 6333656], [6333657, 7125363], [7125364, 7917070], [7917071, 8708777], [8708778, 9500484], [9500485, 10292191], [10292192, 11083898], [11083899, 11875605], [11875606, 12667312], [12667313, 13459019], [13459020, 14250726], [14250727, 15042433], [15042434, 15834155]] SRR3207958 file size 4109969 SRR3207958 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207958 SRR3207958_1.fastq Input file: SRR3207958_1.fastq trimmed: SRR3207958-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:15:21 2025 >> started Tue Feb 11 21:15:29 2025 >> done (8.451s) 15834155 reads processed; of these: 2540 ( 0.02%) short reads filtered out after trimming by size control 165504 ( 1.05%) empty reads filtered out after trimming by size control 15666111 (98.94%) reads available; of these: 659986 ( 4.21%) trimmed reads available after processing 15006125 (95.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 389 0.00% 19 441 0.00% 20 556 0.00% 21 673 0.00% 22 898 0.01% 23 1184 0.01% 24 1496 0.01% 25 1946 0.01% 26 2067 0.01% 27 2119 0.01% 28 2104 0.01% 29 2069 0.01% 30 2125 0.01% 31 2190 0.01% 32 2278 0.01% 33 2334 0.01% 34 2471 0.02% 35 2596 0.02% 36 2785 0.02% 37 2931 0.02% 38 2895 0.02% 39 3022 0.02% 40 3247 0.02% 41 3142 0.02% 42 3277 0.02% 43 3297 0.02% 44 3535 0.02% 45 3592 0.02% 46 3812 0.02% 47 3830 0.02% 48 3930 0.03% 49 4162 0.03% 50 4202 0.03% 51 4320 0.03% 52 4242 0.03% 53 4505 0.03% 54 4733 0.03% 55 4852 0.03% 56 4896 0.03% 57 5073 0.03% 58 5277 0.03% 59 5567 0.04% 60 5587 0.04% 61 5745 0.04% 62 5833 0.04% 63 6095 0.04% 64 6265 0.04% 65 6494 0.04% 66 6822 0.04% 67 7052 0.05% 68 7836 0.05% 69 7907 0.05% 70 7269 0.05% 71 6565 0.04% 72 6614 0.04% 73 6997 0.04% 74 7164 0.05% 75 7315 0.05% 76 5453 0.03% 77 5994 0.04% 78 6442 0.04% 79 6973 0.04% 80 7574 0.05% 81 8065 0.05% 82 8429 0.05% 83 9076 0.06% 84 9517 0.06% 85 9949 0.06% 86 10579 0.07% 87 11279 0.07% 88 12591 0.08% 89 13516 0.09% 90 14632 0.09% 91 16534 0.11% 92 18424 0.12% 93 20977 0.13% 94 24897 0.16% 95 28363 0.18% 96 33291 0.21% 97 39878 0.25% 98 46000 0.29% 99 58933 0.38% 100 15006125 95.79% 15666111 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=51.83 fanout-score-rank=6 prefix-density=0.62 prefix-fanout=38.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=6 fanout-score=199.43 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=24.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 21:15:44 Started mapping on | Feb 11 21:15:44 Finished on | Feb 11 21:16:04 Mapping speed, Million of reads per hour | 2819.90 Number of input reads | 15666111 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14869511 Uniquely mapped reads % | 94.92% Average mapped length | 98.85 Number of splices: Total | 4428511 Number of splices: Annotated (sjdb) | 4348026 Number of splices: GT/AG | 4362183 Number of splices: GC/AG | 54121 Number of splices: AT/AC | 4443 Number of splices: Non-canonical | 7764 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327311 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 50430 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 469289 469289 469289 N_multimapping 327311 327311 327311 N_noFeature 659801 7649528 7772415 N_ambiguous 158299 25568 25584 UnstrandedReadsAssigned:14051411 PositiveStrandReadsAssigned:7194415 NegativeStrandReadsAssigned:7071512 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207958 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207958-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,666,111 reads, 14,378,349 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52401 SRR3207958.ke.tsv 34699 SRR3207958.se.tsv 87100 total ==> SRR3207958.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 449 24.3236 Potri.005G024800.1.v4.1 1035 936 72 7.99675 Potri.004G059700.1.v4.1 961 862 22 2.65321 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 267.375 9.77347 Potri.016G087400.1.v4.1 270 171 537 326.464 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 65 4.03659 Potri.012G127500.1.v4.1 977 878 1523 180.328 ==> SRR3207958.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1549 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 87 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR3207958 completed mapping pipeline successfully