Starting /dee2/code/volunteer_pipeline.sh SRR3207959 current disk space = 3052618993664 free memory = 1576173864 SRR3207959 SRAfilesize 1b9a9b9a0e52f03292774637cb6b0322 SRR3207959.sra SRR3207959.sra file validated SRR3207959 is single end SRR3207959 is conventional basespace SRR3207959 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207959_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11375 34.0 33.0 34.0 31.0 34.0 2 33.2915 34.0 34.0 34.0 31.0 34.0 3 33.3305 34.0 34.0 34.0 31.0 34.0 4 36.5845 37.0 37.0 37.0 35.0 37.0 5 36.481 37.0 37.0 37.0 35.0 37.0 6 36.33925 37.0 37.0 37.0 35.0 37.0 7 36.41875 37.0 37.0 37.0 35.0 37.0 8 36.3595 37.0 37.0 37.0 35.0 37.0 9 38.19475 39.0 39.0 39.0 37.0 39.0 10-11 38.27675000000001 39.0 39.0 39.0 37.0 39.0 12-13 38.354625 39.0 39.0 39.0 37.0 39.0 14-15 40.04625 41.0 40.0 41.0 38.0 41.0 16-17 39.901375 41.0 40.0 41.0 38.0 41.0 18-19 39.85575 41.0 40.0 41.0 38.0 41.0 20-21 39.921625 41.0 40.0 41.0 38.0 41.0 22-23 39.772999999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.844 41.0 40.0 41.0 38.0 41.0 26-27 39.8455 41.0 40.0 41.0 38.0 41.0 28-29 39.718875 41.0 40.0 41.0 38.0 41.0 30-31 39.6365 41.0 40.0 41.0 38.0 41.0 32-33 39.534375 41.0 40.0 41.0 37.0 41.0 34-35 39.54075 41.0 40.0 41.0 37.0 41.0 36-37 39.445875 41.0 40.0 41.0 37.0 41.0 38-39 39.371 41.0 40.0 41.0 37.0 41.0 40-41 39.265375000000006 41.0 39.5 41.0 36.0 41.0 42-43 39.144000000000005 41.0 39.0 41.0 36.0 41.0 44-45 39.1455 41.0 39.0 41.0 36.0 41.0 46-47 39.110749999999996 41.0 39.0 41.0 36.0 41.0 48-49 39.07475 41.0 39.0 41.0 36.0 41.0 50-51 39.215625 41.0 39.0 41.0 36.0 41.0 52-53 39.263000000000005 41.0 39.0 41.0 36.0 41.0 54-55 39.173249999999996 41.0 39.0 41.0 35.5 41.0 56-57 38.545875 41.0 38.5 41.0 34.5 41.0 58-59 38.757374999999996 41.0 38.5 41.0 35.0 41.0 60-61 38.636250000000004 40.0 38.0 41.0 35.0 41.0 62-63 38.464875000000006 40.0 37.0 41.0 35.0 41.0 64-65 38.13825 40.0 37.0 41.0 35.0 41.0 66-67 37.763875 39.0 36.5 41.0 34.0 41.0 68-69 37.4315 39.0 36.0 41.0 34.0 41.0 70-71 36.90275 38.0 35.0 40.0 34.0 41.0 72-73 36.378875 37.0 35.0 39.0 33.0 41.0 74-75 35.889875 37.0 35.0 39.0 33.0 41.0 76-77 34.894499999999994 36.0 34.5 37.0 31.5 39.0 78-79 35.03775 36.0 35.0 37.0 32.5 39.0 80-81 34.863749999999996 35.0 35.0 37.0 33.0 39.0 82-83 34.57825 35.0 35.0 36.5 33.0 37.0 84-85 34.236125 35.0 35.0 36.0 32.5 37.0 86-87 34.051500000000004 35.0 35.0 36.0 32.5 37.0 88-89 33.88375 35.0 35.0 35.0 32.0 36.0 90-91 33.6415 35.0 35.0 35.0 32.0 36.0 92-93 33.562875000000005 35.0 35.0 35.0 32.0 36.0 94-95 33.483999999999995 35.0 34.5 35.0 32.0 36.0 96-97 33.3765 35.0 34.5 35.0 32.0 35.5 98-99 33.357875 35.0 34.5 35.0 32.0 35.0 100 33.1915 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 2.0 16 4.0 17 4.0 18 3.0 19 3.0 20 5.0 21 3.0 22 5.0 23 8.0 24 13.0 25 3.0 26 15.0 27 25.0 28 19.0 29 26.0 30 25.0 31 43.0 32 44.0 33 49.0 34 87.0 35 130.0 36 241.0 37 746.0 38 1843.0 39 643.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.725 16.975 13.100000000000001 45.2 2 19.55 23.974999999999998 39.6 16.875 3 20.025000000000002 28.1 28.499999999999996 23.375 4 23.075000000000003 33.800000000000004 21.525 21.6 5 22.775000000000002 34.975 23.875 18.375 6 19.675 36.35 24.775 19.2 7 15.775 19.625 42.675000000000004 21.925 8 18.475 22.8 30.525000000000002 28.199999999999996 9 19.875 23.825 32.45 23.849999999999998 10-11 22.0625 32.4 23.425 22.112499999999997 12-13 19.85 27.3875 29.299999999999997 23.4625 14-15 21.349999999999998 28.3625 28.3625 21.925 16-17 21.475 28.299999999999997 28.287499999999998 21.9375 18-19 21.5375 27.575 28.1875 22.7 20-21 22.0625 26.525 28.8375 22.575 22-23 21.49018627328416 27.790973871733964 28.078509813726715 22.640330041255158 24-25 21.202650331291412 27.890986373296663 27.678459807475935 23.22790348793599 26-27 21.9625 27.4125 28.499999999999996 22.125 28-29 22.00950950950951 28.015515515515517 27.865365365365363 22.10960960960961 30-31 21.60470647139817 28.288897233696332 27.60045061960195 22.505945675303543 32-33 21.0 28.3625 28.525 22.112499999999997 34-35 21.512500000000003 28.925 27.487499999999997 22.075 36-37 21.875 28.6875 27.05 22.3875 38-39 21.375 28.3375 28.4375 21.85 40-41 22.325 27.5875 28.5875 21.5 42-43 21.975 27.8125 28.4 21.8125 44-45 21.375 27.9375 28.199999999999996 22.4875 46-47 21.725 27.900000000000002 27.9375 22.4375 48-49 21.575 28.225 28.1 22.1 50-51 22.287499999999998 28.1625 27.3875 22.162499999999998 52-53 21.825 28.962500000000002 27.8875 21.325 54-55 22.15 28.549999999999997 27.737499999999997 21.5625 56-57 21.375 28.3875 28.825 21.4125 58-59 21.462500000000002 28.475 28.0625 22.0 60-61 21.1875 27.950000000000003 28.575 22.287499999999998 62-63 21.6125 28.1625 28.6375 21.587500000000002 64-65 21.6125 29.725 27.325 21.337500000000002 66-67 21.5375 29.65 27.1 21.712500000000002 68-69 22.6375 28.8375 27.5625 20.962500000000002 70-71 22.1 28.6875 27.8375 21.375 72-73 21.1625 29.25 27.625 21.9625 74-75 22.0625 28.7 27.975 21.2625 76-77 22.787499999999998 29.1375 26.887499999999996 21.1875 78-79 21.45 29.362500000000004 27.3375 21.85 80-81 21.1625 28.525 27.775 22.537499999999998 82-83 21.3625 28.725 27.650000000000002 22.2625 84-85 22.1375 28.012500000000003 27.462500000000002 22.3875 86-87 21.762500000000003 28.875 27.875 21.4875 88-89 22.5125 27.950000000000003 27.775 21.762500000000003 90-91 21.45 28.0875 28.7375 21.725 92-93 22.1 27.8375 28.65 21.4125 94-95 22.675 28.225 28.487499999999997 20.6125 96-97 22.675 27.8125 27.787499999999998 21.725 98-99 22.0 28.9 27.5875 21.512500000000003 100 20.974999999999998 29.549999999999997 28.775000000000002 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.5 19 3.0 20 0.5 21 2.0 22 3.0 23 2.0 24 1.5 25 1.5 26 3.0 27 8.5 28 13.0 29 16.0 30 17.5 31 25.5 32 40.5 33 50.0 34 58.0 35 72.5 36 96.5 37 110.0 38 132.0 39 163.5 40 201.5 41 250.5 42 251.5 43 264.5 44 285.5 45 265.5 46 261.0 47 253.0 48 209.0 49 170.5 50 154.0 51 131.5 52 112.0 53 93.5 54 72.0 55 50.0 56 38.5 57 28.0 58 14.0 59 14.0 60 14.0 61 9.0 62 6.0 63 6.5 64 6.5 65 5.5 66 3.5 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.1 30-31 0.13749999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84905660377359 99.225 2 0.12578616352201258 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 21 0.525 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.0875 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1375 0.0 0.0 0.025 0.0 82-83 0.16249999999999998 0.0 0.0 0.025 0.0 84-85 0.2 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88 0.2 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716377 spots for SRR3207959.sra Written 716377 spots for SRR3207959.sra Read 716386 spots for SRR3207959.sra Written 716386 spots for SRR3207959.sra SRR ids: ['SRR3207959.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_prx6koim SRR3207959.sra spots: 14327549 blocks: [[1, 716377], [716378, 1432754], [1432755, 2149131], [2149132, 2865508], [2865509, 3581885], [3581886, 4298262], [4298263, 5014639], [5014640, 5731016], [5731017, 6447393], [6447394, 7163770], [7163771, 7880147], [7880148, 8596524], [8596525, 9312901], [9312902, 10029278], [10029279, 10745655], [10745656, 11462032], [11462033, 12178409], [12178410, 12894786], [12894787, 13611163], [13611164, 14327549]] SRR3207959 file size 3717868 SRR3207959 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207959 SRR3207959_1.fastq Input file: SRR3207959_1.fastq trimmed: SRR3207959-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:31:14 2025 >> started Tue Feb 11 21:31:22 2025 >> done (7.566s) 14327549 reads processed; of these: 1683 ( 0.01%) short reads filtered out after trimming by size control 72653 ( 0.51%) empty reads filtered out after trimming by size control 14253213 (99.48%) reads available; of these: 547515 ( 3.84%) trimmed reads available after processing 13705698 (96.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 278 0.00% 19 355 0.00% 20 428 0.00% 21 498 0.00% 22 659 0.00% 23 893 0.01% 24 1211 0.01% 25 1482 0.01% 26 1584 0.01% 27 1641 0.01% 28 1578 0.01% 29 1607 0.01% 30 1651 0.01% 31 1687 0.01% 32 1764 0.01% 33 1799 0.01% 34 1903 0.01% 35 2014 0.01% 36 2097 0.01% 37 2140 0.02% 38 2252 0.02% 39 2394 0.02% 40 2410 0.02% 41 2425 0.02% 42 2633 0.02% 43 2657 0.02% 44 2749 0.02% 45 2731 0.02% 46 2765 0.02% 47 2778 0.02% 48 2971 0.02% 49 3130 0.02% 50 2997 0.02% 51 3183 0.02% 52 3370 0.02% 53 3555 0.02% 54 3630 0.03% 55 3765 0.03% 56 3810 0.03% 57 3916 0.03% 58 4003 0.03% 59 4421 0.03% 60 4422 0.03% 61 4441 0.03% 62 4461 0.03% 63 4686 0.03% 64 4843 0.03% 65 4908 0.03% 66 5215 0.04% 67 5300 0.04% 68 5967 0.04% 69 5513 0.04% 70 5451 0.04% 71 5368 0.04% 72 5372 0.04% 73 5802 0.04% 74 5833 0.04% 75 5935 0.04% 76 4353 0.03% 77 4909 0.03% 78 5400 0.04% 79 5896 0.04% 80 6423 0.05% 81 6678 0.05% 82 7179 0.05% 83 7820 0.05% 84 8046 0.06% 85 8410 0.06% 86 9059 0.06% 87 9828 0.07% 88 10416 0.07% 89 11285 0.08% 90 12404 0.09% 91 14102 0.10% 92 15946 0.11% 93 17809 0.12% 94 21098 0.15% 95 24645 0.17% 96 28838 0.20% 97 34437 0.24% 98 40138 0.28% 99 53065 0.37% 100 13705698 96.16% 14253213 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=30.43 fanout-score-rank=12 prefix-density=0.29 prefix-fanout=26.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=284.49 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 21:31:40 Started mapping on | Feb 11 21:31:40 Finished on | Feb 11 21:31:55 Mapping speed, Million of reads per hour | 3420.77 Number of input reads | 14253213 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13680161 Uniquely mapped reads % | 95.98% Average mapped length | 98.99 Number of splices: Total | 4122074 Number of splices: Annotated (sjdb) | 4049722 Number of splices: GT/AG | 4059667 Number of splices: GC/AG | 51428 Number of splices: AT/AC | 4152 Number of splices: Non-canonical | 6827 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294330 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 40604 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.66% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278722 278722 278722 N_multimapping 294330 294330 294330 N_noFeature 614248 7055954 7144784 N_ambiguous 139295 22765 23068 UnstrandedReadsAssigned:12926618 PositiveStrandReadsAssigned:6601442 NegativeStrandReadsAssigned:6512309 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207959 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207959-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,253,213 reads, 13,213,438 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR3207959.ke.tsv 34699 SRR3207959.se.tsv 87100 total ==> SRR3207959.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 436 25.4736 Potri.005G024800.1.v4.1 1035 936 52 6.22883 Potri.004G059700.1.v4.1 961 862 17 2.21116 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 205.263 8.0921 Potri.016G087400.1.v4.1 270 171 435 285.215 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 32.4158 2.17111 Potri.012G127500.1.v4.1 977 878 1716 219.13 ==> SRR3207959.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 52 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207959 completed mapping pipeline successfully