Starting /dee2/code/volunteer_pipeline.sh SRR3207960 current disk space = 3052914585600 free memory = 1418955564 SRR3207960 SRAfilesize a18329ac5ca589965e66fa76e31f8aa1 SRR3207960.sra SRR3207960.sra file validated SRR3207960 is single end SRR3207960 is conventional basespace SRR3207960 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207960_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2445 34.0 33.0 34.0 31.0 34.0 2 33.37825 34.0 34.0 34.0 31.0 34.0 3 33.42025 34.0 34.0 34.0 31.0 34.0 4 36.6615 37.0 37.0 37.0 35.0 37.0 5 36.59725 37.0 37.0 37.0 35.0 37.0 6 36.49425 37.0 37.0 37.0 35.0 37.0 7 36.5685 37.0 37.0 37.0 35.0 37.0 8 36.46475 37.0 37.0 37.0 35.0 37.0 9 38.40775 39.0 39.0 39.0 37.0 39.0 10-11 38.385000000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.471875 39.0 39.0 39.0 37.0 39.0 14-15 40.170500000000004 41.0 40.0 41.0 38.0 41.0 16-17 40.067 41.0 40.0 41.0 38.0 41.0 18-19 40.005624999999995 41.0 40.0 41.0 38.0 41.0 20-21 40.088125 41.0 40.0 41.0 38.0 41.0 22-23 39.993375 41.0 40.0 41.0 38.0 41.0 24-25 39.921625 41.0 40.0 41.0 38.0 41.0 26-27 40.0125 41.0 40.0 41.0 38.0 41.0 28-29 39.890625 41.0 40.0 41.0 38.0 41.0 30-31 39.816125 41.0 40.0 41.0 38.0 41.0 32-33 39.69 41.0 40.0 41.0 38.0 41.0 34-35 39.660250000000005 41.0 40.0 41.0 37.5 41.0 36-37 39.600875 41.0 40.0 41.0 37.5 41.0 38-39 39.565625 41.0 40.0 41.0 37.0 41.0 40-41 39.46325 41.0 40.0 41.0 37.0 41.0 42-43 39.40525 41.0 40.0 41.0 37.0 41.0 44-45 39.44625 41.0 40.0 41.0 37.0 41.0 46-47 39.320125 41.0 39.5 41.0 37.0 41.0 48-49 39.364125 41.0 39.5 41.0 37.0 41.0 50-51 39.547625 41.0 40.0 41.0 37.0 41.0 52-53 39.48225 41.0 40.0 41.0 37.0 41.0 54-55 39.38 41.0 39.0 41.0 36.0 41.0 56-57 38.907875000000004 41.0 39.0 41.0 35.0 41.0 58-59 38.991749999999996 41.0 39.0 41.0 35.0 41.0 60-61 38.799 40.5 38.0 41.0 35.0 41.0 62-63 38.655874999999995 40.0 37.5 41.0 35.0 41.0 64-65 38.336 39.5 37.0 41.0 35.0 41.0 66-67 38.0015 39.0 36.5 41.0 35.0 41.0 68-69 37.61325 39.0 36.0 41.0 34.5 41.0 70-71 37.065 38.0 35.5 40.0 34.0 41.0 72-73 36.406375 37.0 35.0 39.0 34.0 41.0 74-75 36.0165 36.5 35.0 39.0 33.5 41.0 76-77 34.977 36.0 34.5 37.0 31.5 39.0 78-79 35.051375 36.0 35.0 37.0 33.0 39.0 80-81 34.93425 35.0 35.0 37.0 33.0 39.0 82-83 34.672875000000005 35.0 35.0 36.5 33.0 37.0 84-85 34.473375000000004 35.0 35.0 36.0 33.0 37.0 86-87 34.139375 35.0 35.0 36.0 33.0 37.0 88-89 33.934625 35.0 35.0 35.0 32.5 36.0 90-91 33.714 35.0 35.0 35.0 32.0 36.0 92-93 33.667249999999996 35.0 35.0 35.0 32.0 36.0 94-95 33.610375 35.0 35.0 35.0 32.5 36.0 96-97 33.5305 35.0 35.0 35.0 32.0 35.5 98-99 33.372749999999996 35.0 35.0 35.0 32.0 35.0 100 33.1935 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 2.0 15 2.0 16 1.0 17 4.0 18 0.0 19 4.0 20 6.0 21 0.0 22 2.0 23 4.0 24 8.0 25 7.0 26 14.0 27 22.0 28 24.0 29 23.0 30 21.0 31 32.0 32 35.0 33 57.0 34 84.0 35 127.0 36 232.0 37 713.0 38 1917.0 39 653.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.775 14.6 14.799999999999999 45.824999999999996 2 18.525 23.125 40.300000000000004 18.05 3 21.85 27.05 27.900000000000002 23.200000000000003 4 22.75 34.175 21.25 21.825 5 23.75 35.949999999999996 22.900000000000002 17.4 6 19.075 36.55 24.575 19.8 7 16.725 17.025000000000002 45.175 21.075 8 19.475 23.724999999999998 29.25 27.55 9 20.724999999999998 23.35 32.45 23.474999999999998 10-11 22.3625 32.9875 23.45 21.2 12-13 20.525 25.4375 29.849999999999998 24.1875 14-15 20.9 27.037499999999998 29.3875 22.675 16-17 22.2125 27.5125 28.1875 22.0875 18-19 21.2375 28.1375 27.6875 22.9375 20-21 21.5375 27.8625 27.712500000000002 22.8875 22-23 21.352669083635455 29.26615826978372 27.040880110013752 22.340292536567073 24-25 21.057896711266725 28.660747780417655 27.960485181943227 22.32087032637239 26-27 21.212500000000002 27.450000000000003 28.3125 23.025000000000002 28-29 21.95945945945946 27.602602602602605 28.566066066066064 21.871871871871875 30-31 21.483983983983983 27.515015015015017 28.766266266266268 22.234734734734733 32-33 21.175 29.212500000000002 27.950000000000003 21.6625 34-35 21.8 27.787499999999998 28.000000000000004 22.412499999999998 36-37 22.2625 28.15 27.6875 21.9 38-39 21.7875 29.375 27.025 21.8125 40-41 22.15 28.375 27.3625 22.112499999999997 42-43 21.45 28.549999999999997 28.262500000000003 21.7375 44-45 21.224999999999998 28.875 28.1 21.8 46-47 21.45 28.487499999999997 27.6125 22.45 48-49 20.875 28.4375 28.299999999999997 22.3875 50-51 21.3875 28.175 27.5625 22.875 52-53 21.637500000000003 28.287499999999998 27.6375 22.4375 54-55 21.55 27.825 28.349999999999998 22.275 56-57 21.7875 28.725 27.700000000000003 21.7875 58-59 21.8125 26.737499999999997 29.012500000000003 22.4375 60-61 21.45 27.3375 28.425 22.787499999999998 62-63 22.0875 27.200000000000003 29.15 21.5625 64-65 21.575 28.275 28.849999999999998 21.3 66-67 20.775 29.25 27.700000000000003 22.275 68-69 21.95 29.049999999999997 27.487499999999997 21.512500000000003 70-71 21.55 29.425 28.1 20.925 72-73 21.7375 28.9375 27.3125 22.0125 74-75 22.4625 28.6625 27.400000000000002 21.475 76-77 21.875 28.9 27.224999999999998 22.0 78-79 21.6875 28.1875 27.3 22.825 80-81 21.85 29.525000000000002 27.3875 21.2375 82-83 21.25 29.3375 27.750000000000004 21.6625 84-85 21.1125 28.599999999999998 28.325 21.9625 86-87 21.5625 28.1375 28.537499999999998 21.762500000000003 88-89 22.3625 27.6625 27.6125 22.3625 90-91 22.0875 27.575 27.85 22.4875 92-93 22.325 28.9 28.000000000000004 20.775 94-95 22.650000000000002 27.9375 27.8375 21.575 96-97 21.987499999999997 27.6875 27.900000000000002 22.425 98-99 22.575 27.675 27.675 22.075 100 22.725 29.099999999999998 27.1 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.0 25 2.5 26 4.0 27 4.0 28 4.0 29 7.5 30 16.0 31 30.5 32 39.5 33 41.0 34 57.5 35 75.0 36 92.0 37 113.0 38 129.0 39 159.0 40 193.5 41 230.5 42 263.0 43 269.5 44 284.5 45 292.0 46 270.0 47 259.0 48 232.0 49 199.0 50 163.0 51 128.5 52 106.0 53 80.0 54 71.0 55 50.0 56 28.5 57 23.0 58 22.0 59 16.0 60 9.5 61 8.0 62 4.5 63 2.5 64 2.5 65 3.0 66 1.5 67 1.0 68 1.0 69 1.0 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0375 26-27 0.0 28-29 0.1 30-31 0.1 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89916813713134 99.075 2 0.050415931434333254 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025207965717166627 0.22499999999999998 >10 0.025207965717166627 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 24 0.6 TruSeq Adapter, Index 12 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 9 0.22499999999999998 TruSeq Adapter, Index 12 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.225 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.225 0.0 0.0 0.0 0.0 8 0.225 0.0 0.0 0.0 0.0 9 0.225 0.0 0.0 0.0 0.0 10-11 0.225 0.0 0.0 0.0 0.0 12-13 0.225 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.275 0.0 0.0 0.0 0.0 60-61 0.275 0.0 0.0 0.0 0.0 62-63 0.275 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 25 0.0048637707 56.4 1 GAGCACA 25 0.0048637707 56.4 9 ATCGGAA 25 0.0048637707 56.4 2 TCACCTT 25 2.748136E-5 47.000004 30-31 ATCTCGT 20 5.3435756E-4 47.0 40-41 TGCCGTC 20 5.3435756E-4 47.0 48-49 CCAGTCA 20 5.3435756E-4 47.0 26-27 CCGTCTT 20 5.3435756E-4 47.0 50-51 ACCTTGT 20 5.3435756E-4 47.0 32-33 CTTGTAA 20 5.3435756E-4 47.0 34-35 CTTGAAA 20 5.3435756E-4 47.0 60-61 AGTCACC 20 5.3435756E-4 47.0 28-29 CACACGT 25 0.0016030063 37.600002 12-13 CACGTCT 25 0.0016030063 37.600002 14-15 TATGCCG 25 0.0016030063 37.600002 46-47 TAATCTC 25 0.0016030063 37.600002 38-39 GTCTTCT 25 0.0016030063 37.600002 52-53 CGTATGC 25 0.0016030063 37.600002 44-45 TCTGAAC 25 0.0016030063 37.600002 18-19 CTCGTAT 25 0.0016030063 37.600002 42-43 >>END_MODULE Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564120 spots for SRR3207960.sra Written 564120 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra Read 564110 spots for SRR3207960.sra Written 564110 spots for SRR3207960.sra SRR ids: ['SRR3207960.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gzoa8x4w SRR3207960.sra spots: 11282210 blocks: [[1, 564110], [564111, 1128220], [1128221, 1692330], [1692331, 2256440], [2256441, 2820550], [2820551, 3384660], [3384661, 3948770], [3948771, 4512880], [4512881, 5076990], [5076991, 5641100], [5641101, 6205210], [6205211, 6769320], [6769321, 7333430], [7333431, 7897540], [7897541, 8461650], [8461651, 9025760], [9025761, 9589870], [9589871, 10153980], [10153981, 10718090], [10718091, 11282210]] SRR3207960 file size 2925333 SRR3207960 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207960 SRR3207960_1.fastq Input file: SRR3207960_1.fastq trimmed: SRR3207960-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:47:02 2025 >> started Tue Feb 11 20:47:08 2025 >> done (5.948s) 11282210 reads processed; of these: 861 ( 0.01%) short reads filtered out after trimming by size control 102928 ( 0.91%) empty reads filtered out after trimming by size control 11178421 (99.08%) reads available; of these: 421814 ( 3.77%) trimmed reads available after processing 10756607 (96.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 138 0.00% 19 195 0.00% 20 225 0.00% 21 325 0.00% 22 381 0.00% 23 574 0.01% 24 790 0.01% 25 1005 0.01% 26 1114 0.01% 27 1146 0.01% 28 1164 0.01% 29 1124 0.01% 30 1159 0.01% 31 1152 0.01% 32 1224 0.01% 33 1294 0.01% 34 1424 0.01% 35 1430 0.01% 36 1511 0.01% 37 1606 0.01% 38 1521 0.01% 39 1671 0.01% 40 1799 0.02% 41 1772 0.02% 42 1914 0.02% 43 1868 0.02% 44 1873 0.02% 45 1960 0.02% 46 2091 0.02% 47 2071 0.02% 48 2240 0.02% 49 2328 0.02% 50 2342 0.02% 51 2497 0.02% 52 2476 0.02% 53 2555 0.02% 54 2731 0.02% 55 2817 0.03% 56 2899 0.03% 57 2975 0.03% 58 3190 0.03% 59 3289 0.03% 60 3456 0.03% 61 3547 0.03% 62 3679 0.03% 63 3724 0.03% 64 3910 0.03% 65 4252 0.04% 66 4254 0.04% 67 4301 0.04% 68 5097 0.05% 69 4744 0.04% 70 4670 0.04% 71 4218 0.04% 72 4202 0.04% 73 4552 0.04% 74 4719 0.04% 75 4502 0.04% 76 3425 0.03% 77 3754 0.03% 78 4189 0.04% 79 4661 0.04% 80 4846 0.04% 81 5093 0.05% 82 5308 0.05% 83 5976 0.05% 84 6195 0.06% 85 6644 0.06% 86 6840 0.06% 87 7292 0.07% 88 8073 0.07% 89 8881 0.08% 90 9864 0.09% 91 10820 0.10% 92 12370 0.11% 93 14175 0.13% 94 16425 0.15% 95 18846 0.17% 96 22323 0.20% 97 26772 0.24% 98 31031 0.28% 99 40324 0.36% 100 10756607 96.23% 11178421 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=51.46 fanout-score-rank=10 prefix-density=0.79 prefix-fanout=36.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=305.84 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=29.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 20:47:28 Started mapping on | Feb 11 20:47:28 Finished on | Feb 11 20:47:40 Mapping speed, Million of reads per hour | 3353.53 Number of input reads | 11178421 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10766599 Uniquely mapped reads % | 96.32% Average mapped length | 98.93 Number of splices: Total | 3369148 Number of splices: Annotated (sjdb) | 3308855 Number of splices: GT/AG | 3318208 Number of splices: GC/AG | 42052 Number of splices: AT/AC | 3267 Number of splices: Non-canonical | 5621 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236073 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 44548 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 175749 175749 175749 N_multimapping 236073 236073 236073 N_noFeature 450808 5515923 5630406 N_ambiguous 108775 18900 18968 UnstrandedReadsAssigned:10207016 PositiveStrandReadsAssigned:5231776 NegativeStrandReadsAssigned:5117225 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207960 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207960-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,178,421 reads, 10,448,646 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR3207960.ke.tsv 34699 SRR3207960.se.tsv 87100 total ==> SRR3207960.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 403 29.9762 Potri.005G024800.1.v4.1 1035 936 53 8.08251 Potri.004G059700.1.v4.1 961 862 12 1.9871 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 189.195 9.49567 Potri.016G087400.1.v4.1 270 171 335.499 280.054 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46 3.92237 Potri.012G127500.1.v4.1 977 878 1392 226.303 ==> SRR3207960.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 855 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207960 completed mapping pipeline successfully