Starting /dee2/code/volunteer_pipeline.sh SRR3207961 current disk space = 3052888543232 free memory = 1433312444 SRR3207961 SRAfilesize 66247f4ca9606b1512cd187951c10548 SRR3207961.sra SRR3207961.sra file validated SRR3207961 is single end SRR3207961 is conventional basespace SRR3207961 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207961_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13525 34.0 33.0 34.0 31.0 34.0 2 33.2875 34.0 34.0 34.0 31.0 34.0 3 33.36825 34.0 34.0 34.0 31.0 34.0 4 36.6125 37.0 37.0 37.0 35.0 37.0 5 36.55925 37.0 37.0 37.0 35.0 37.0 6 36.3635 37.0 37.0 37.0 35.0 37.0 7 36.468 37.0 37.0 37.0 35.0 37.0 8 36.4015 37.0 37.0 37.0 35.0 37.0 9 38.20225 39.0 39.0 39.0 37.0 39.0 10-11 38.24875 39.0 39.0 39.0 37.0 39.0 12-13 38.37 39.0 39.0 39.0 37.0 39.0 14-15 40.060249999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.928375 41.0 40.0 41.0 38.0 41.0 18-19 39.864374999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.9985 41.0 40.0 41.0 38.0 41.0 22-23 39.8795 41.0 40.0 41.0 38.0 41.0 24-25 39.8785 41.0 40.0 41.0 38.0 41.0 26-27 39.91325 41.0 40.0 41.0 38.0 41.0 28-29 39.855374999999995 41.0 40.0 41.0 38.0 41.0 30-31 39.670125 41.0 40.0 41.0 38.0 41.0 32-33 39.575374999999994 41.0 40.0 41.0 37.0 41.0 34-35 39.58225 41.0 40.0 41.0 37.0 41.0 36-37 39.47525 41.0 40.0 41.0 37.0 41.0 38-39 39.468374999999995 41.0 40.0 41.0 37.0 41.0 40-41 39.335875 41.0 40.0 41.0 37.0 41.0 42-43 39.266125 41.0 39.0 41.0 36.5 41.0 44-45 39.256 41.0 39.0 41.0 36.5 41.0 46-47 39.181 41.0 39.0 41.0 36.0 41.0 48-49 39.149625 41.0 39.0 41.0 36.0 41.0 50-51 39.279624999999996 41.0 39.0 41.0 36.0 41.0 52-53 39.32475 41.0 39.5 41.0 36.0 41.0 54-55 39.198125000000005 41.0 39.0 41.0 36.0 41.0 56-57 38.638374999999996 40.5 38.5 41.0 34.5 41.0 58-59 38.824124999999995 41.0 38.5 41.0 35.0 41.0 60-61 38.725875 40.0 38.0 41.0 35.0 41.0 62-63 38.5285 40.0 37.5 41.0 35.0 41.0 64-65 38.2355 40.0 37.0 41.0 35.0 41.0 66-67 37.754000000000005 39.0 36.0 41.0 34.0 41.0 68-69 37.527375000000006 39.0 36.0 41.0 34.0 41.0 70-71 37.01 38.0 35.5 40.0 34.0 41.0 72-73 36.171125 37.0 35.0 39.0 33.0 41.0 74-75 35.730999999999995 36.5 35.0 39.0 33.0 41.0 76-77 34.71125 36.0 34.5 37.5 31.5 39.0 78-79 34.841125 36.0 35.0 37.0 32.5 39.0 80-81 34.6515 35.0 35.0 37.0 32.5 39.0 82-83 34.373875 35.0 35.0 36.5 33.0 37.5 84-85 34.040625000000006 35.0 35.0 36.0 32.0 37.0 86-87 33.844375 35.0 35.0 36.0 32.0 37.0 88-89 33.696124999999995 35.0 35.0 35.5 32.0 36.0 90-91 33.471999999999994 35.0 35.0 35.0 32.0 36.0 92-93 33.391125 35.0 35.0 35.0 32.0 36.0 94-95 33.3535 35.0 34.5 35.0 31.5 36.0 96-97 33.216375 35.0 34.0 35.0 31.5 36.0 98-99 33.185625 35.0 34.0 35.0 31.0 35.0 100 33.02925 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 3.0 11 1.0 12 1.0 13 3.0 14 2.0 15 3.0 16 3.0 17 1.0 18 3.0 19 5.0 20 4.0 21 2.0 22 8.0 23 9.0 24 11.0 25 8.0 26 8.0 27 20.0 28 26.0 29 22.0 30 19.0 31 39.0 32 44.0 33 73.0 34 88.0 35 143.0 36 245.0 37 732.0 38 1827.0 39 640.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.674999999999997 16.025 16.525000000000002 41.775 2 18.2 25.3 38.224999999999994 18.275 3 19.125 27.3 29.625 23.95 4 22.5 34.699999999999996 20.4 22.400000000000002 5 23.799999999999997 35.675000000000004 22.525000000000002 18.0 6 18.325 36.575 25.124999999999996 19.975 7 16.625 18.0 44.725 20.65 8 20.150000000000002 22.025 29.65 28.175 9 19.3 24.25 31.55 24.9 10-11 23.025000000000002 33.4125 22.1375 21.425 12-13 20.3625 26.224999999999998 30.075000000000003 23.3375 14-15 20.5875 27.625 28.712500000000002 23.075000000000003 16-17 21.65 27.6375 28.050000000000004 22.662499999999998 18-19 21.325 27.462500000000002 28.65 22.5625 20-21 21.637500000000003 26.737499999999997 29.5375 22.0875 22-23 21.392848212053014 29.057264316079017 27.74443610902726 21.80545136284071 24-25 20.830207551887973 28.794698674668666 28.632158039509875 21.742935733933482 26-27 21.4875 27.987499999999997 28.125 22.400000000000002 28-29 22.137404580152673 28.29433112251283 27.74371167563509 21.82455262169941 30-31 20.656394839032945 28.13478642114493 29.237128898910186 21.97168984091194 32-33 21.85 27.725 28.037499999999998 22.3875 34-35 21.325 29.1625 26.9125 22.6 36-37 21.15 27.6625 28.6125 22.575 38-39 21.587500000000002 27.775 28.3125 22.325 40-41 21.55 28.4 27.625 22.425 42-43 21.9625 28.0625 28.962500000000002 21.0125 44-45 21.512500000000003 27.4125 28.775000000000002 22.3 46-47 22.0 27.787499999999998 27.55 22.662499999999998 48-49 21.2 28.050000000000004 29.3875 21.3625 50-51 21.8125 27.8125 28.299999999999997 22.075 52-53 21.525 28.275 27.800000000000004 22.400000000000002 54-55 22.412499999999998 28.425 27.85 21.3125 56-57 21.0625 27.712500000000002 29.075 22.15 58-59 21.1625 28.012500000000003 29.3875 21.4375 60-61 21.6625 28.3625 29.312500000000004 20.6625 62-63 21.4 27.975 28.9125 21.712500000000002 64-65 21.8875 27.725 28.7 21.6875 66-67 21.6125 28.825 28.349999999999998 21.212500000000002 68-69 21.925 27.85 28.537499999999998 21.6875 70-71 21.8875 28.8875 28.349999999999998 20.875 72-73 20.9875 29.049999999999997 28.6875 21.275 74-75 22.4875 28.275 27.9125 21.325 76-77 21.6875 29.012500000000003 27.8375 21.462500000000002 78-79 21.5 28.275 29.212500000000002 21.0125 80-81 21.325 28.549999999999997 28.325 21.8 82-83 21.7875 28.762500000000003 28.5875 20.8625 84-85 21.2625 28.462500000000002 28.3375 21.9375 86-87 21.3125 28.925 27.925 21.837500000000002 88-89 21.512500000000003 28.3875 28.725 21.375 90-91 21.6875 27.8375 28.3375 22.1375 92-93 21.7875 27.462500000000002 28.8625 21.8875 94-95 22.375 28.249999999999996 28.275 21.099999999999998 96-97 21.525 27.375 28.749999999999996 22.35 98-99 22.1 28.475 27.85 21.575 100 21.349999999999998 29.525000000000002 28.15 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 0.5 24 1.0 25 4.5 26 8.0 27 10.5 28 11.5 29 13.5 30 18.5 31 26.5 32 33.0 33 51.0 34 67.0 35 81.0 36 109.0 37 128.5 38 143.0 39 181.5 40 229.0 41 248.5 42 250.0 43 261.5 44 255.5 45 253.0 46 247.0 47 228.0 48 225.5 49 198.0 50 155.0 51 119.5 52 99.5 53 87.5 54 66.5 55 47.5 56 32.0 57 21.0 58 19.5 59 16.5 60 9.5 61 4.0 62 6.0 63 6.0 64 3.5 65 3.5 66 3.0 67 3.0 68 3.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.025 24-25 0.025 26-27 0.0 28-29 0.11249999999999999 30-31 0.21250000000000002 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77232481659499 98.6 2 0.17708069820389577 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05059448520111307 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 30 0.75 TruSeq Adapter, Index 13 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTA 12 0.3 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.3 0.0 0.0 0.0 0.0 2 0.3 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.3 0.0 0.0 0.0 0.0 5 0.3 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.3 0.0 0.0 0.0 0.0 8 0.3 0.0 0.0 0.0 0.0 9 0.3 0.0 0.0 0.0 0.0 10-11 0.3 0.0 0.0 0.0 0.0 12-13 0.3 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.325 0.0 0.0 0.0 0.0 18-19 0.325 0.0 0.0 0.0 0.0 20-21 0.325 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.3375 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.35 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.3625 0.0 0.0 0.0 0.0 42-43 0.375 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.375 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.4 0.0 0.0 0.0 0.0 52-53 0.425 0.0 0.0 0.0 0.0 54-55 0.425 0.0 0.0 0.0 0.0 56-57 0.425 0.0 0.0 0.0 0.0 58-59 0.425 0.0 0.0 0.0 0.0 60-61 0.45 0.0 0.0 0.0 0.0 62-63 0.45 0.0 0.0 0.0 0.0 64-65 0.45 0.0 0.0 0.0 0.0 66-67 0.45 0.0 0.0 0.0 0.0 68-69 0.45 0.0 0.0 0.0 0.0 70-71 0.45 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861241 spots for SRR3207961.sra Written 861241 spots for SRR3207961.sra Read 861259 spots for SRR3207961.sra Written 861259 spots for SRR3207961.sra SRR ids: ['SRR3207961.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3rn4092e SRR3207961.sra spots: 17224838 blocks: [[1, 861241], [861242, 1722482], [1722483, 2583723], [2583724, 3444964], [3444965, 4306205], [4306206, 5167446], [5167447, 6028687], [6028688, 6889928], [6889929, 7751169], [7751170, 8612410], [8612411, 9473651], [9473652, 10334892], [10334893, 11196133], [11196134, 12057374], [12057375, 12918615], [12918616, 13779856], [13779857, 14641097], [14641098, 15502338], [15502339, 16363579], [16363580, 17224838]] SRR3207961 file size 4471896 SRR3207961 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207961 SRR3207961_1.fastq Input file: SRR3207961_1.fastq trimmed: SRR3207961-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 20:42:53 2025 >> started Tue Feb 11 20:43:01 2025 >> done (8.293s) 17224838 reads processed; of these: 1651 ( 0.01%) short reads filtered out after trimming by size control 221388 ( 1.29%) empty reads filtered out after trimming by size control 17001799 (98.71%) reads available; of these: 666639 ( 3.92%) trimmed reads available after processing 16335160 (96.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 253 0.00% 19 366 0.00% 20 792 0.00% 21 587 0.00% 22 721 0.00% 23 1053 0.01% 24 1364 0.01% 25 1656 0.01% 26 1865 0.01% 27 1762 0.01% 28 1887 0.01% 29 1836 0.01% 30 1900 0.01% 31 1979 0.01% 32 2224 0.01% 33 2151 0.01% 34 2257 0.01% 35 2291 0.01% 36 2487 0.01% 37 2701 0.02% 38 2933 0.02% 39 2845 0.02% 40 2923 0.02% 41 3001 0.02% 42 3292 0.02% 43 3061 0.02% 44 3201 0.02% 45 3172 0.02% 46 3408 0.02% 47 3331 0.02% 48 3909 0.02% 49 3764 0.02% 50 4215 0.02% 51 3847 0.02% 52 4130 0.02% 53 4342 0.03% 54 4806 0.03% 55 4532 0.03% 56 4896 0.03% 57 4707 0.03% 58 5441 0.03% 59 5596 0.03% 60 5908 0.03% 61 5402 0.03% 62 5969 0.04% 63 5793 0.03% 64 6445 0.04% 65 6641 0.04% 66 6192 0.04% 67 6094 0.04% 68 6372 0.04% 69 6256 0.04% 70 7457 0.04% 71 8845 0.05% 72 7685 0.05% 73 7352 0.04% 74 7347 0.04% 75 7303 0.04% 76 5261 0.03% 77 5979 0.04% 78 6439 0.04% 79 7128 0.04% 80 7681 0.05% 81 8015 0.05% 82 8724 0.05% 83 9446 0.06% 84 9735 0.06% 85 10167 0.06% 86 10735 0.06% 87 11641 0.07% 88 12546 0.07% 89 13759 0.08% 90 15406 0.09% 91 16847 0.10% 92 18787 0.11% 93 21472 0.13% 94 25429 0.15% 95 29660 0.17% 96 34904 0.21% 97 41613 0.24% 98 48067 0.28% 99 62653 0.37% 100 16335160 96.08% 17001799 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=35.19 fanout-score-rank=10 prefix-density=0.29 prefix-fanout=28.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=271.34 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 20:43:17 Started mapping on | Feb 11 20:43:17 Finished on | Feb 11 20:43:33 Mapping speed, Million of reads per hour | 3825.40 Number of input reads | 17001799 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 16335815 Uniquely mapped reads % | 96.08% Average mapped length | 99.00 Number of splices: Total | 4897608 Number of splices: Annotated (sjdb) | 4813837 Number of splices: GT/AG | 4824553 Number of splices: GC/AG | 60327 Number of splices: AT/AC | 4871 Number of splices: Non-canonical | 7857 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344177 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 116443 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321807 321807 321807 N_multimapping 344177 344177 344177 N_noFeature 726254 8407316 8540237 N_ambiguous 168100 26830 27032 UnstrandedReadsAssigned:15441461 PositiveStrandReadsAssigned:7901669 NegativeStrandReadsAssigned:7768546 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207961 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207961-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,001,799 reads, 15,834,738 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR3207961.ke.tsv 34699 SRR3207961.se.tsv 87100 total ==> SRR3207961.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 354 17.5763 Potri.005G024800.1.v4.1 1035 936 37 3.76639 Potri.004G059700.1.v4.1 961 862 26 2.87386 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 265.334 8.88921 Potri.016G087400.1.v4.1 270 171 573 319.27 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 38 2.16286 Potri.012G127500.1.v4.1 977 878 1461 158.546 ==> SRR3207961.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1942 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207961 completed mapping pipeline successfully