Starting /dee2/code/volunteer_pipeline.sh SRR3207962 current disk space = 3052602478592 free memory = 1576477148 SRR3207962 SRAfilesize 84d3309c34121313b51001714794f83f SRR3207962.sra SRR3207962.sra file validated SRR3207962 is single end SRR3207962 is conventional basespace SRR3207962 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207962_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.219 34.0 33.0 34.0 31.0 34.0 2 33.33075 34.0 34.0 34.0 31.0 34.0 3 33.4005 34.0 34.0 34.0 31.0 34.0 4 36.63675 37.0 37.0 37.0 35.0 37.0 5 36.5675 37.0 37.0 37.0 35.0 37.0 6 36.41575 37.0 37.0 37.0 35.0 37.0 7 36.5635 37.0 37.0 37.0 35.0 37.0 8 36.42275 37.0 37.0 37.0 35.0 37.0 9 38.30925 39.0 39.0 39.0 37.0 39.0 10-11 38.287875 39.0 39.0 39.0 37.0 39.0 12-13 38.387125 39.0 39.0 39.0 37.0 39.0 14-15 40.11175 41.0 40.0 41.0 38.0 41.0 16-17 39.967 41.0 40.0 41.0 38.0 41.0 18-19 39.918625 41.0 40.0 41.0 38.0 41.0 20-21 40.072874999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.893375 41.0 40.0 41.0 38.0 41.0 24-25 39.929625 41.0 40.0 41.0 38.0 41.0 26-27 39.987875 41.0 40.0 41.0 38.0 41.0 28-29 39.869749999999996 41.0 40.0 41.0 38.0 41.0 30-31 39.769125 41.0 40.0 41.0 38.0 41.0 32-33 39.636125 41.0 40.0 41.0 37.0 41.0 34-35 39.66525 41.0 40.0 41.0 38.0 41.0 36-37 39.582125000000005 41.0 40.0 41.0 37.0 41.0 38-39 39.561875 41.0 40.0 41.0 37.0 41.0 40-41 39.462375 41.0 40.0 41.0 37.0 41.0 42-43 39.383624999999995 41.0 39.5 41.0 36.5 41.0 44-45 39.361625000000004 41.0 39.5 41.0 36.5 41.0 46-47 39.312250000000006 41.0 39.0 41.0 36.0 41.0 48-49 39.30475 41.0 39.0 41.0 36.0 41.0 50-51 39.415625 41.0 39.5 41.0 36.0 41.0 52-53 39.408625 41.0 39.5 41.0 36.0 41.0 54-55 39.30925 41.0 39.0 41.0 36.0 41.0 56-57 38.830875 41.0 38.5 41.0 35.0 41.0 58-59 38.965374999999995 41.0 39.0 41.0 35.0 41.0 60-61 38.801625 40.5 38.0 41.0 35.0 41.0 62-63 38.635999999999996 40.0 37.5 41.0 35.0 41.0 64-65 38.37775 40.0 37.0 41.0 35.0 41.0 66-67 37.956500000000005 39.0 36.5 41.0 34.0 41.0 68-69 37.645125 39.0 36.0 41.0 34.0 41.0 70-71 37.22525 38.5 35.5 40.5 34.0 41.0 72-73 36.487625 37.0 35.0 39.0 33.5 41.0 74-75 36.1325 37.0 35.0 39.0 33.5 41.0 76-77 35.166 36.0 34.5 37.5 31.5 39.0 78-79 35.286 36.0 35.0 37.0 33.0 39.0 80-81 35.089875 35.5 35.0 37.0 33.0 39.0 82-83 34.722125 35.0 35.0 36.5 33.0 37.5 84-85 34.4815 35.0 35.0 36.0 33.0 37.0 86-87 34.236625000000004 35.0 35.0 36.0 33.0 37.0 88-89 34.032624999999996 35.0 35.0 35.5 32.0 36.0 90-91 33.837374999999994 35.0 35.0 35.0 32.0 36.0 92-93 33.780125 35.0 35.0 35.0 32.0 36.0 94-95 33.658500000000004 35.0 35.0 35.0 32.0 36.0 96-97 33.557249999999996 35.0 35.0 35.0 32.0 35.5 98-99 33.396125 35.0 34.0 35.0 31.5 35.0 100 33.23 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 3.0 20 5.0 21 1.0 22 4.0 23 6.0 24 6.0 25 6.0 26 12.0 27 14.0 28 24.0 29 24.0 30 26.0 31 37.0 32 44.0 33 64.0 34 82.0 35 145.0 36 263.0 37 692.0 38 1866.0 39 668.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.75 16.0 13.65 45.6 2 18.125 24.975 38.3 18.6 3 20.925 28.225 28.050000000000004 22.8 4 24.0 32.525 20.825 22.650000000000002 5 22.655663915978995 36.03400850212553 23.13078269567392 18.179544886221557 6 18.4 37.45 25.374999999999996 18.775 7 17.349999999999998 18.375 43.675000000000004 20.599999999999998 8 17.849999999999998 24.825 30.375000000000004 26.950000000000003 9 19.950000000000003 22.6 31.974999999999998 25.474999999999998 10-11 22.625 33.7125 21.5625 22.1 12-13 20.474999999999998 26.8375 30.4625 22.225 14-15 21.099999999999998 27.987499999999997 28.625 22.287499999999998 16-17 22.375 27.6375 27.737499999999997 22.25 18-19 20.8625 28.675 28.449999999999996 22.0125 20-21 21.95 28.199999999999996 28.012500000000003 21.837500000000002 22-23 20.525 29.525000000000002 27.5625 22.3875 24-25 20.69267316829207 29.532383095773945 27.79444861215304 21.980495123780948 26-27 21.45 28.95 27.437499999999996 22.162499999999998 28-29 21.32132132132132 29.22922922922923 27.164664664664667 22.284784784784783 30-31 21.767430216547755 28.16372512204281 28.564275879334083 21.504568782075353 32-33 22.375 28.575 27.55 21.5 34-35 22.125 28.6875 27.737499999999997 21.45 36-37 21.5375 28.275 28.037499999999998 22.15 38-39 20.825 29.212500000000002 27.6375 22.325 40-41 22.287499999999998 29.012500000000003 27.250000000000004 21.45 42-43 21.2875 28.4375 28.6625 21.6125 44-45 20.7875 28.487499999999997 29.075 21.65 46-47 21.8 28.075 28.275 21.85 48-49 21.2875 27.9125 28.537499999999998 22.2625 50-51 20.424999999999997 28.762500000000003 28.999999999999996 21.8125 52-53 20.724999999999998 28.849999999999998 28.499999999999996 21.925 54-55 22.112499999999997 28.7375 27.750000000000004 21.4 56-57 21.212500000000002 28.012500000000003 28.0875 22.6875 58-59 21.512500000000003 28.787499999999998 28.1375 21.5625 60-61 22.2 28.3125 28.487499999999997 21.0 62-63 21.075 28.1 29.549999999999997 21.275 64-65 21.95 27.2625 29.45 21.337500000000002 66-67 22.4375 28.0875 27.925 21.55 68-69 21.4375 28.95 28.15 21.462500000000002 70-71 21.275 29.4875 28.1875 21.05 72-73 21.575 28.3625 28.9375 21.125 74-75 20.4375 28.3875 28.462500000000002 22.7125 76-77 21.55 28.237499999999997 28.425 21.7875 78-79 21.2625 28.15 28.449999999999996 22.1375 80-81 21.4125 28.3375 28.075 22.175 82-83 21.1625 28.4375 28.3875 22.0125 84-85 22.4625 27.400000000000002 28.537499999999998 21.6 86-87 21.525 27.400000000000002 28.6625 22.412499999999998 88-89 22.400000000000002 28.512500000000003 28.075 21.0125 90-91 21.2 28.975 28.1625 21.6625 92-93 21.4375 28.249999999999996 28.825 21.4875 94-95 22.162499999999998 27.962500000000002 27.6625 22.2125 96-97 21.8875 28.549999999999997 28.0625 21.5 98-99 22.2 27.787499999999998 28.575 21.4375 100 21.7 28.975 28.249999999999996 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 3.5 25 4.5 26 4.0 27 8.5 28 11.0 29 14.0 30 19.5 31 27.0 32 42.5 33 48.5 34 60.5 35 85.5 36 108.0 37 131.0 38 148.0 39 173.0 40 222.5 41 245.5 42 261.0 43 262.5 44 255.5 45 270.0 46 263.0 47 258.5 48 224.0 49 169.5 50 136.0 51 111.0 52 101.0 53 85.5 54 60.0 55 44.0 56 33.0 57 24.5 58 20.5 59 15.0 60 12.0 61 8.5 62 5.0 63 5.5 64 4.0 65 1.5 66 1.0 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.1 30-31 0.13749999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94972347913524 99.4 2 0.0 0.0 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 20 0.5 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870640 spots for SRR3207962.sra Written 870640 spots for SRR3207962.sra Read 870651 spots for SRR3207962.sra Written 870651 spots for SRR3207962.sra SRR ids: ['SRR3207962.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j577ylxv SRR3207962.sra spots: 17412811 blocks: [[1, 870640], [870641, 1741280], [1741281, 2611920], [2611921, 3482560], [3482561, 4353200], [4353201, 5223840], [5223841, 6094480], [6094481, 6965120], [6965121, 7835760], [7835761, 8706400], [8706401, 9577040], [9577041, 10447680], [10447681, 11318320], [11318321, 12188960], [12188961, 13059600], [13059601, 13930240], [13930241, 14800880], [14800881, 15671520], [15671521, 16542160], [16542161, 17412811]] SRR3207962 file size 4520807 SRR3207962 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207962 SRR3207962_1.fastq Input file: SRR3207962_1.fastq trimmed: SRR3207962-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:32:53 2025 >> started Tue Feb 11 21:33:05 2025 >> done (11.765s) 17412811 reads processed; of these: 1969 ( 0.01%) short reads filtered out after trimming by size control 95234 ( 0.55%) empty reads filtered out after trimming by size control 17315608 (99.44%) reads available; of these: 669180 ( 3.86%) trimmed reads available after processing 16646428 (96.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 308 0.00% 19 386 0.00% 20 598 0.00% 21 597 0.00% 22 753 0.00% 23 1032 0.01% 24 1458 0.01% 25 1844 0.01% 26 1838 0.01% 27 1936 0.01% 28 1836 0.01% 29 1962 0.01% 30 2210 0.01% 31 2060 0.01% 32 2262 0.01% 33 2212 0.01% 34 2370 0.01% 35 2444 0.01% 36 2719 0.02% 37 2644 0.02% 38 2627 0.02% 39 3424 0.02% 40 2949 0.02% 41 3067 0.02% 42 3226 0.02% 43 3137 0.02% 44 3172 0.02% 45 3339 0.02% 46 3436 0.02% 47 3399 0.02% 48 3638 0.02% 49 3722 0.02% 50 3644 0.02% 51 3834 0.02% 52 3993 0.02% 53 4056 0.02% 54 4271 0.02% 55 4327 0.02% 56 4501 0.03% 57 4680 0.03% 58 4744 0.03% 59 4851 0.03% 60 5176 0.03% 61 5255 0.03% 62 5278 0.03% 63 5333 0.03% 64 5714 0.03% 65 5905 0.03% 66 5976 0.03% 67 6207 0.04% 68 6312 0.04% 69 6042 0.03% 70 6588 0.04% 71 7021 0.04% 72 7137 0.04% 73 7246 0.04% 74 7359 0.04% 75 7410 0.04% 76 5318 0.03% 77 5949 0.03% 78 6627 0.04% 79 7152 0.04% 80 7699 0.04% 81 8317 0.05% 82 8773 0.05% 83 9813 0.06% 84 9799 0.06% 85 10437 0.06% 86 10954 0.06% 87 11977 0.07% 88 13119 0.08% 89 13905 0.08% 90 15691 0.09% 91 17523 0.10% 92 19490 0.11% 93 22149 0.13% 94 26184 0.15% 95 30265 0.17% 96 35575 0.21% 97 42757 0.25% 98 49781 0.29% 99 64461 0.37% 100 16646428 96.14% 17315608 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=32.68 fanout-score-rank=14 prefix-density=0.26 prefix-fanout=27.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=288.34 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.6 sequence=TTCTTCTTCTTT Started job on | Feb 11 21:33:21 Started mapping on | Feb 11 21:33:21 Finished on | Feb 11 21:33:42 Mapping speed, Million of reads per hour | 2968.39 Number of input reads | 17315608 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 16660838 Uniquely mapped reads % | 96.22% Average mapped length | 98.99 Number of splices: Total | 4989838 Number of splices: Annotated (sjdb) | 4902959 Number of splices: GT/AG | 4914320 Number of splices: GC/AG | 62541 Number of splices: AT/AC | 4904 Number of splices: Non-canonical | 8073 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362795 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 55110 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 291975 291975 291975 N_multimapping 362795 362795 362795 N_noFeature 747215 8607253 8687596 N_ambiguous 168681 27567 28206 UnstrandedReadsAssigned:15744942 PositiveStrandReadsAssigned:8026018 NegativeStrandReadsAssigned:7945036 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207962 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207962-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,315,608 reads, 16,100,770 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR3207962.ke.tsv 34699 SRR3207962.se.tsv 87100 total ==> SRR3207962.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 422 20.293 Potri.005G024800.1.v4.1 1035 936 90 8.87309 Potri.004G059700.1.v4.1 961 862 21 2.24812 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 291.237 9.44985 Potri.016G087400.1.v4.1 270 171 612 330.266 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 44 2.42552 Potri.012G127500.1.v4.1 977 878 1931 202.953 ==> SRR3207962.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1575 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 50 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207962 completed mapping pipeline successfully