Starting /dee2/code/volunteer_pipeline.sh SRR3207963 current disk space = 3052591439872 free memory = 1575549844 SRR3207963 SRAfilesize 1fd816b7ec63d77ec978b00e7443c6a0 SRR3207963.sra SRR3207963.sra file validated SRR3207963 is single end SRR3207963 is conventional basespace SRR3207963 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207963_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.162 34.0 33.0 34.0 31.0 34.0 2 33.31325 34.0 34.0 34.0 31.0 34.0 3 33.348 34.0 34.0 34.0 31.0 34.0 4 36.59125 37.0 37.0 37.0 35.0 37.0 5 36.54425 37.0 37.0 37.0 35.0 37.0 6 36.3925 37.0 37.0 37.0 35.0 37.0 7 36.46575 37.0 37.0 37.0 35.0 37.0 8 36.34375 37.0 37.0 37.0 35.0 37.0 9 38.256 39.0 39.0 39.0 37.0 39.0 10-11 38.275625000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.34162499999999 39.0 39.0 39.0 37.0 39.0 14-15 39.965375 41.0 40.0 41.0 38.0 41.0 16-17 39.851 41.0 40.0 41.0 38.0 41.0 18-19 39.834 41.0 40.0 41.0 38.0 41.0 20-21 39.870625000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.76275 41.0 40.0 41.0 38.0 41.0 24-25 39.7305 41.0 40.0 41.0 38.0 41.0 26-27 39.7745 41.0 40.0 41.0 38.0 41.0 28-29 39.703375 41.0 40.0 41.0 38.0 41.0 30-31 39.611125 41.0 40.0 41.0 37.5 41.0 32-33 39.520125 41.0 40.0 41.0 37.0 41.0 34-35 39.51825 41.0 40.0 41.0 37.0 41.0 36-37 39.356 41.0 40.0 41.0 37.0 41.0 38-39 39.30275 41.0 40.0 41.0 37.0 41.0 40-41 39.207750000000004 41.0 39.5 41.0 36.5 41.0 42-43 39.116875 41.0 39.0 41.0 36.0 41.0 44-45 39.087625 41.0 39.0 41.0 36.0 41.0 46-47 39.006874999999994 41.0 39.0 41.0 36.0 41.0 48-49 39.014624999999995 41.0 39.0 41.0 35.5 41.0 50-51 39.176375 41.0 39.5 41.0 36.0 41.0 52-53 39.187 41.0 39.5 41.0 36.0 41.0 54-55 39.003 41.0 39.0 41.0 35.0 41.0 56-57 38.545 41.0 38.5 41.0 34.5 41.0 58-59 38.629875 41.0 39.0 41.0 35.0 41.0 60-61 38.50725 40.5 38.0 41.0 35.0 41.0 62-63 38.314499999999995 40.0 38.0 41.0 35.0 41.0 64-65 38.02075 40.0 37.0 41.0 34.5 41.0 66-67 37.647875 39.0 36.5 41.0 34.0 41.0 68-69 37.396125 39.0 36.0 41.0 34.0 41.0 70-71 36.8675 38.5 35.5 40.5 34.0 41.0 72-73 36.174375 37.0 35.0 39.0 33.0 41.0 74-75 35.791125 37.0 35.0 39.0 33.0 41.0 76-77 34.831125 36.0 34.5 38.0 31.0 39.0 78-79 34.908 36.0 35.0 37.0 32.0 39.0 80-81 34.7025 35.5 35.0 37.0 32.5 39.0 82-83 34.4345 35.0 35.0 36.5 32.5 37.5 84-85 34.14675 35.0 35.0 36.0 32.5 37.0 86-87 33.883624999999995 35.0 35.0 36.0 32.0 37.0 88-89 33.685249999999996 35.0 35.0 35.5 32.0 36.0 90-91 33.505125 35.0 35.0 35.0 32.0 36.0 92-93 33.452 35.0 35.0 35.0 32.0 36.0 94-95 33.399875 35.0 35.0 35.0 32.0 36.0 96-97 33.287 35.0 35.0 35.0 31.5 35.5 98-99 33.0445 35.0 34.0 35.0 31.0 35.0 100 32.927 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 1.0 8 2.0 9 2.0 10 4.0 11 4.0 12 7.0 13 3.0 14 2.0 15 3.0 16 5.0 17 4.0 18 7.0 19 3.0 20 4.0 21 3.0 22 10.0 23 9.0 24 7.0 25 8.0 26 9.0 27 17.0 28 21.0 29 25.0 30 18.0 31 42.0 32 46.0 33 69.0 34 74.0 35 116.0 36 271.0 37 699.0 38 1807.0 39 696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.175 16.925 13.600000000000001 45.300000000000004 2 17.375 26.0 40.525 16.1 3 19.375 28.199999999999996 30.225 22.2 4 23.150000000000002 33.75 20.925 22.175 5 22.475 36.875 22.1 18.55 6 17.4 36.7 26.325 19.575 7 15.725 18.275 44.2 21.8 8 17.95 24.575 30.825000000000003 26.650000000000002 9 19.650000000000002 23.925 32.65 23.775 10-11 22.9875 33.025 22.475 21.512500000000003 12-13 20.0625 26.2875 30.912499999999998 22.7375 14-15 20.9875 27.8625 29.9875 21.1625 16-17 21.1875 28.375 28.025 22.412499999999998 18-19 21.087500000000002 29.049999999999997 27.575 22.287499999999998 20-21 21.7 28.125 28.3625 21.8125 22-23 21.212500000000002 29.4875 27.737499999999997 21.5625 24-25 20.885442721360683 29.177088544272134 28.251625812906454 21.68584292146073 26-27 20.8 28.3875 28.499999999999996 22.3125 28-29 21.46878518703866 28.812711122231953 27.874390091329914 21.844113599399474 30-31 21.70920920920921 28.603603603603606 28.47847847847848 21.20870870870871 32-33 21.025 28.825 29.099999999999998 21.05 34-35 20.3875 28.599999999999998 29.65 21.3625 36-37 21.2875 28.575 28.1125 22.025 38-39 21.0375 29.475 28.599999999999998 20.8875 40-41 20.6875 28.9375 28.012500000000003 22.3625 42-43 20.8125 28.512500000000003 29.0875 21.587500000000002 44-45 21.525 28.5875 28.7375 21.15 46-47 21.85 29.037499999999998 27.3875 21.725 48-49 20.9875 28.575 28.199999999999996 22.237499999999997 50-51 20.9125 28.3125 28.4375 22.3375 52-53 21.512500000000003 29.025000000000002 27.150000000000002 22.3125 54-55 21.8125 28.675 28.675 20.837500000000002 56-57 22.0 28.6875 27.575 21.7375 58-59 21.025 27.987499999999997 28.3375 22.650000000000002 60-61 20.4875 28.825 28.1 22.5875 62-63 21.2 29.099999999999998 28.849999999999998 20.849999999999998 64-65 20.9875 29.3375 28.425 21.25 66-67 20.724999999999998 28.8875 28.1 22.287499999999998 68-69 21.6875 28.65 28.000000000000004 21.6625 70-71 22.125 28.6625 28.050000000000004 21.1625 72-73 21.6 29.3375 27.700000000000003 21.3625 74-75 21.3875 28.9875 29.062500000000004 20.5625 76-77 22.7 28.799999999999997 27.275 21.224999999999998 78-79 21.2875 28.9 28.1125 21.7 80-81 21.85 27.762500000000003 28.6125 21.775 82-83 21.875 28.9125 28.375 20.837500000000002 84-85 21.6 28.5625 28.000000000000004 21.837500000000002 86-87 21.9625 28.512500000000003 28.549999999999997 20.974999999999998 88-89 22.35 28.725 27.437499999999996 21.4875 90-91 21.25 28.9375 29.4 20.4125 92-93 22.175 29.062500000000004 28.449999999999996 20.3125 94-95 21.912499999999998 29.6375 27.1125 21.337500000000002 96-97 21.5 29.125 27.35 22.025 98-99 22.25 28.6125 28.487499999999997 20.65 100 21.2 28.675 28.1 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.5 23 2.5 24 1.0 25 5.5 26 9.5 27 9.0 28 13.5 29 15.5 30 19.5 31 28.5 32 39.5 33 51.0 34 62.0 35 84.0 36 113.0 37 133.0 38 164.0 39 190.5 40 206.5 41 245.5 42 287.0 43 286.5 44 290.0 45 282.5 46 248.5 47 227.0 48 199.5 49 175.0 50 150.5 51 115.5 52 86.0 53 63.5 54 43.5 55 34.5 56 23.0 57 21.5 58 19.5 59 10.0 60 8.0 61 5.0 62 6.5 63 6.5 64 1.0 65 2.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.05 26-27 0.0 28-29 0.08750000000000001 30-31 0.1 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51947395042995 98.375 2 0.37936267071320184 0.75 3 0.0 0.0 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025290844714213456 0.17500000000000002 8 0.025290844714213456 0.2 9 0.0 0.0 >10 0.025290844714213456 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 16 0.4 TruSeq Adapter, Index 15 (97% over 40bp) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTA 7 0.17500000000000002 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.275 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.3 0.0 0.0 0.0 0.0 50-51 0.3 0.0 0.0 0.0 0.0 52-53 0.325 0.0 0.0 0.0 0.0 54-55 0.325 0.0 0.0 0.0 0.0 56-57 0.3375 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.3625 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.375 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608483 spots for SRR3207963.sra Written 608483 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra Read 608468 spots for SRR3207963.sra Written 608468 spots for SRR3207963.sra SRR ids: ['SRR3207963.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_53a27sis SRR3207963.sra spots: 12169375 blocks: [[1, 608468], [608469, 1216936], [1216937, 1825404], [1825405, 2433872], [2433873, 3042340], [3042341, 3650808], [3650809, 4259276], [4259277, 4867744], [4867745, 5476212], [5476213, 6084680], [6084681, 6693148], [6693149, 7301616], [7301617, 7910084], [7910085, 8518552], [8518553, 9127020], [9127021, 9735488], [9735489, 10343956], [10343957, 10952424], [10952425, 11560892], [11560893, 12169375]] SRR3207963 file size 3156220 SRR3207963 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207963 SRR3207963_1.fastq Input file: SRR3207963_1.fastq trimmed: SRR3207963-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:02:02 2025 >> started Tue Feb 11 22:02:07 2025 >> done (5.829s) 12169375 reads processed; of these: 1732 ( 0.01%) short reads filtered out after trimming by size control 77959 ( 0.64%) empty reads filtered out after trimming by size control 12089684 (99.35%) reads available; of these: 515522 ( 4.26%) trimmed reads available after processing 11574162 (95.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 596 0.00% 19 654 0.01% 20 414 0.00% 21 627 0.01% 22 529 0.00% 23 690 0.01% 24 1160 0.01% 25 1366 0.01% 26 1308 0.01% 27 1556 0.01% 28 1351 0.01% 29 1635 0.01% 30 1388 0.01% 31 1593 0.01% 32 1840 0.02% 33 2436 0.02% 34 2207 0.02% 35 1686 0.01% 36 1923 0.02% 37 5097 0.04% 38 3028 0.03% 39 2442 0.02% 40 5021 0.04% 41 3098 0.03% 42 4441 0.04% 43 3707 0.03% 44 2966 0.02% 45 3667 0.03% 46 2675 0.02% 47 2833 0.02% 48 2784 0.02% 49 3156 0.03% 50 3250 0.03% 51 3872 0.03% 52 3909 0.03% 53 5845 0.05% 54 4711 0.04% 55 4761 0.04% 56 4426 0.04% 57 4990 0.04% 58 5448 0.05% 59 6037 0.05% 60 5589 0.05% 61 5086 0.04% 62 6303 0.05% 63 4961 0.04% 64 6048 0.05% 65 6875 0.06% 66 5659 0.05% 67 5185 0.04% 68 5937 0.05% 69 4426 0.04% 70 5280 0.04% 71 6467 0.05% 72 6362 0.05% 73 5657 0.05% 74 5036 0.04% 75 4963 0.04% 76 3828 0.03% 77 4081 0.03% 78 4851 0.04% 79 6047 0.05% 80 5574 0.05% 81 5355 0.04% 82 5626 0.05% 83 6409 0.05% 84 6879 0.06% 85 7325 0.06% 86 7846 0.06% 87 8114 0.07% 88 9065 0.07% 89 10419 0.09% 90 12603 0.10% 91 12060 0.10% 92 12986 0.11% 93 14468 0.12% 94 17589 0.15% 95 20016 0.17% 96 23634 0.20% 97 28329 0.23% 98 32769 0.27% 99 42692 0.35% 100 11574162 95.74% 12089684 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=50.64 fanout-score-rank=12 prefix-density=0.88 prefix-fanout=35.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=328.76 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=29.6 sequence=TTCTTCTTCTTC Started job on | Feb 11 22:02:34 Started mapping on | Feb 11 22:02:34 Finished on | Feb 11 22:02:51 Mapping speed, Million of reads per hour | 2560.17 Number of input reads | 12089684 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11507148 Uniquely mapped reads % | 95.18% Average mapped length | 98.89 Number of splices: Total | 3521147 Number of splices: Annotated (sjdb) | 3459136 Number of splices: GT/AG | 3467007 Number of splices: GC/AG | 44775 Number of splices: AT/AC | 3461 Number of splices: Non-canonical | 5904 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238695 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 43455 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 343841 343841 343841 N_multimapping 238695 238695 238695 N_noFeature 546410 5930126 6050082 N_ambiguous 111438 19383 18881 UnstrandedReadsAssigned:10849300 PositiveStrandReadsAssigned:5557639 NegativeStrandReadsAssigned:5438185 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207963 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207963-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,089,684 reads, 11,077,893 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR3207963.ke.tsv 34699 SRR3207963.se.tsv 87100 total ==> SRR3207963.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 293 21.0775 Potri.005G024800.1.v4.1 1035 936 29 4.27709 Potri.004G059700.1.v4.1 961 862 11 1.76162 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 145.158 7.04594 Potri.016G087400.1.v4.1 270 171 395 318.88 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 42 3.46354 Potri.012G127500.1.v4.1 977 878 1427 224.366 ==> SRR3207963.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1087 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207963 completed mapping pipeline successfully