Starting /dee2/code/volunteer_pipeline.sh SRR3207964 current disk space = 3052681801728 free memory = 1508535520 SRR3207964 SRAfilesize b5bc82fafa129ce91b9e0813f5e21e8f SRR3207964.sra SRR3207964.sra file validated SRR3207964 is single end SRR3207964 is conventional basespace SRR3207964 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94025 34.0 31.0 34.0 31.0 34.0 2 33.15175 34.0 34.0 34.0 31.0 34.0 3 33.2605 34.0 34.0 34.0 31.0 34.0 4 36.531 37.0 37.0 37.0 35.0 37.0 5 36.41025 37.0 37.0 37.0 35.0 37.0 6 36.44675 37.0 37.0 37.0 35.0 37.0 7 36.44075 37.0 37.0 37.0 35.0 37.0 8 36.488 37.0 37.0 37.0 35.0 37.0 9 38.26325 39.0 39.0 39.0 37.0 39.0 10-11 38.228125000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.256874999999994 39.0 39.0 39.0 37.0 39.0 14-15 39.92375 41.0 40.0 41.0 38.0 41.0 16-17 39.957750000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.90975 41.0 40.0 41.0 38.0 41.0 20-21 39.896249999999995 41.0 40.0 41.0 38.0 41.0 22-23 39.509375 41.0 40.0 41.0 36.5 41.0 24-25 39.771 41.0 40.0 41.0 38.0 41.0 26-27 39.709 41.0 40.0 41.0 38.0 41.0 28-29 39.635374999999996 41.0 40.0 41.0 37.5 41.0 30-31 39.454 41.0 40.0 41.0 37.0 41.0 32-33 39.246375 41.0 39.5 41.0 36.0 41.0 34-35 39.32275 41.0 39.5 41.0 36.5 41.0 36-37 39.29575 41.0 40.0 41.0 37.0 41.0 38-39 39.18275 41.0 39.0 41.0 36.0 41.0 40-41 39.009625 40.0 39.0 41.0 36.0 41.0 42-43 39.14775 40.5 39.0 41.0 36.0 41.0 44-45 39.07325 41.0 39.0 41.0 35.5 41.0 46-47 38.967875 41.0 39.0 41.0 35.5 41.0 48-49 38.809875 40.5 39.0 41.0 35.0 41.0 50-51 39.056875000000005 41.0 39.0 41.0 35.5 41.0 52-53 39.159375 41.0 39.0 41.0 36.0 41.0 54-55 38.93825 41.0 39.0 41.0 35.5 41.0 56-57 38.742374999999996 41.0 38.5 41.0 35.0 41.0 58-59 38.42975 40.5 38.0 41.0 34.5 41.0 60-61 38.385875 40.0 38.0 41.0 35.0 41.0 62-63 38.234624999999994 40.0 37.0 41.0 35.0 41.0 64-65 37.837374999999994 39.0 37.0 41.0 34.0 41.0 66-67 37.62125 39.0 36.0 41.0 34.0 41.0 68-69 37.206125 39.0 36.0 41.0 34.0 41.0 70-71 36.632 37.5 35.0 40.0 33.5 41.0 72-73 36.194625 37.0 35.0 39.0 33.0 41.0 74-75 35.649249999999995 36.5 35.0 39.0 33.0 41.0 76-77 34.728624999999994 35.5 34.5 37.0 31.5 39.0 78-79 34.743375 35.5 35.0 37.0 32.0 39.0 80-81 34.431625 35.0 35.0 37.0 32.0 39.0 82-83 34.225375 35.0 35.0 36.0 32.0 37.0 84-85 33.975875 35.0 35.0 36.0 32.0 37.0 86-87 33.76475000000001 35.0 35.0 36.0 32.0 37.0 88-89 33.267624999999995 35.0 34.0 35.0 30.5 36.0 90-91 33.385374999999996 35.0 34.0 35.0 31.0 36.0 92-93 33.358375 35.0 35.0 35.0 32.0 36.0 94-95 33.235375000000005 35.0 34.5 35.0 31.0 36.0 96-97 33.13225 35.0 34.0 35.0 31.0 35.5 98-99 33.031125 35.0 34.0 35.0 31.0 35.0 100 32.961 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 2.0 9 1.0 10 1.0 11 4.0 12 1.0 13 3.0 14 8.0 15 0.0 16 3.0 17 2.0 18 5.0 19 5.0 20 11.0 21 6.0 22 9.0 23 5.0 24 11.0 25 10.0 26 12.0 27 26.0 28 27.0 29 21.0 30 24.0 31 33.0 32 55.0 33 51.0 34 94.0 35 155.0 36 284.0 37 720.0 38 1815.0 39 591.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.425 15.6 17.5 42.475 2 19.275000000000002 24.05 37.4 19.275000000000002 3 20.375 27.500000000000004 28.725 23.400000000000002 4 23.1 33.95 21.075 21.875 5 24.025 34.75 22.400000000000002 18.825 6 18.825 36.7 24.75 19.725 7 16.625 17.95 43.45 21.975 8 19.0 23.974999999999998 29.45 27.575 9 19.5 24.3 31.674999999999997 24.525 10-11 23.799999999999997 32.574999999999996 22.35 21.275 12-13 20.849999999999998 25.5125 30.2125 23.425 14-15 20.7 28.0875 29.0875 22.125 16-17 22.8 27.3 27.8125 22.0875 18-19 21.65 28.349999999999998 27.762500000000003 22.237499999999997 20-21 21.087500000000002 27.650000000000002 29.012500000000003 22.25 22-23 22.5 28.3625 27.800000000000004 21.337500000000002 24-25 20.91511438929866 28.703587948493563 28.378547318414803 22.00275034379297 26-27 21.3 27.85 28.799999999999997 22.05 28-29 22.095785919719894 27.5728398149306 28.560710266349883 21.770663998999627 30-31 21.320495185694636 27.947980492684753 27.77291484306615 22.958609478554457 32-33 20.8 29.4 27.474999999999998 22.325 34-35 22.5125 27.875 27.212500000000002 22.400000000000002 36-37 21.987499999999997 28.625 27.450000000000003 21.9375 38-39 21.5375 28.1375 28.175 22.15 40-41 22.112499999999997 27.8875 28.575 21.425 42-43 20.925 27.987499999999997 29.2875 21.8 44-45 21.512500000000003 28.037499999999998 28.037499999999998 22.412499999999998 46-47 21.275 28.9375 27.9375 21.85 48-49 20.95 27.6 28.712500000000002 22.7375 50-51 21.325 28.15 28.15 22.375 52-53 21.987499999999997 27.737499999999997 28.3875 21.8875 54-55 21.2625 28.6125 28.000000000000004 22.125 56-57 20.9375 28.4125 28.1875 22.4625 58-59 21.75 27.462500000000002 28.6375 22.15 60-61 21.0 28.000000000000004 28.775000000000002 22.225 62-63 21.462500000000002 27.800000000000004 28.499999999999996 22.237499999999997 64-65 21.2375 28.925 28.025 21.8125 66-67 22.475 28.6625 27.150000000000002 21.712500000000002 68-69 21.462500000000002 29.037499999999998 28.375 21.125 70-71 21.087500000000002 29.25 27.725 21.9375 72-73 20.8125 28.95 27.55 22.6875 74-75 21.775 28.825 27.0875 22.3125 76-77 21.725 28.349999999999998 28.65 21.275 78-79 21.7 27.8625 28.299999999999997 22.1375 80-81 21.725 28.7375 27.487499999999997 22.05 82-83 22.1375 27.925 27.8125 22.125 84-85 20.837500000000002 28.9125 27.825 22.425 86-87 21.762500000000003 28.012500000000003 28.7375 21.4875 88-89 21.825 28.299999999999997 27.8375 22.037499999999998 90-91 21.3875 28.6375 27.5875 22.3875 92-93 22.237499999999997 28.1125 27.825 21.825 94-95 21.5375 28.8375 27.8875 21.7375 96-97 22.3375 27.900000000000002 28.287499999999998 21.475 98-99 21.762500000000003 28.249999999999996 28.0875 21.9 100 20.275000000000002 27.525 29.225 22.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.5 26 6.0 27 8.0 28 9.5 29 14.5 30 21.0 31 25.5 32 35.0 33 48.5 34 56.0 35 70.5 36 87.0 37 106.5 38 137.0 39 177.5 40 217.0 41 225.0 42 243.0 43 280.5 44 285.0 45 277.5 46 271.0 47 244.5 48 224.0 49 194.5 50 156.5 51 134.0 52 107.0 53 78.0 54 66.5 55 55.0 56 35.5 57 24.0 58 17.5 59 13.0 60 9.0 61 5.0 62 2.5 63 6.0 64 5.5 65 2.5 66 1.5 67 0.0 68 0.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0375 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77272727272727 98.775 2 0.17676767676767677 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050505050505050504 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 23 0.575 TruSeq Adapter, Index 7 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG 12 0.3 TruSeq Adapter, Index 7 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.35 0.0 0.0 0.0 0.0 2 0.35 0.0 0.0 0.0 0.0 3 0.35 0.0 0.0 0.0 0.0 4 0.35 0.0 0.0 0.0 0.0 5 0.35 0.0 0.0 0.0 0.0 6 0.35 0.0 0.0 0.0 0.0 7 0.35 0.0 0.0 0.0 0.0 8 0.35 0.0 0.0 0.0 0.0 9 0.35 0.0 0.0 0.0 0.0 10-11 0.35 0.0 0.0 0.0 0.0 12-13 0.35 0.0 0.0 0.0 0.0 14-15 0.35 0.0 0.0 0.0 0.0 16-17 0.35 0.0 0.0 0.0 0.0 18-19 0.35 0.0 0.0 0.0 0.0 20-21 0.35 0.0 0.0 0.0 0.0 22-23 0.35 0.0 0.0 0.0 0.0 24-25 0.35 0.0 0.0 0.0 0.0 26-27 0.35 0.0 0.0 0.0 0.0 28-29 0.35 0.0 0.0 0.0 0.0 30-31 0.35 0.0 0.0 0.0 0.0 32-33 0.35 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.35 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.35 0.0 0.0 0.0 0.0 46-47 0.35 0.0 0.0 0.0 0.0 48-49 0.35 0.0 0.0 0.0 0.0 50-51 0.35 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.35 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.375 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra Read 564758 spots for SRR3207964.sra Written 564758 spots for SRR3207964.sra SRR ids: ['SRR3207964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_szdx6168 SRR3207964.sra spots: 11295160 blocks: [[1, 564758], [564759, 1129516], [1129517, 1694274], [1694275, 2259032], [2259033, 2823790], [2823791, 3388548], [3388549, 3953306], [3953307, 4518064], [4518065, 5082822], [5082823, 5647580], [5647581, 6212338], [6212339, 6777096], [6777097, 7341854], [7341855, 7906612], [7906613, 8471370], [8471371, 9036128], [9036129, 9600886], [9600887, 10165644], [10165645, 10730402], [10730403, 11295160]] SRR3207964 file size 2928617 SRR3207964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207964 SRR3207964_1.fastq Input file: SRR3207964_1.fastq trimmed: SRR3207964-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:26:10 2025 >> started Tue Feb 11 21:26:18 2025 >> done (7.736s) 11295160 reads processed; of these: 1154 ( 0.01%) short reads filtered out after trimming by size control 109309 ( 0.97%) empty reads filtered out after trimming by size control 11184697 (99.02%) reads available; of these: 439631 ( 3.93%) trimmed reads available after processing 10745066 (96.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 194 0.00% 19 256 0.00% 20 313 0.00% 21 342 0.00% 22 496 0.00% 23 689 0.01% 24 904 0.01% 25 1167 0.01% 26 1353 0.01% 27 1402 0.01% 28 1314 0.01% 29 1411 0.01% 30 1319 0.01% 31 1381 0.01% 32 1420 0.01% 33 1400 0.01% 34 1468 0.01% 35 1622 0.01% 36 1707 0.02% 37 1681 0.02% 38 1677 0.01% 39 1784 0.02% 40 1748 0.02% 41 1881 0.02% 42 2031 0.02% 43 2058 0.02% 44 2069 0.02% 45 2171 0.02% 46 2237 0.02% 47 2262 0.02% 48 2335 0.02% 49 2543 0.02% 50 2382 0.02% 51 2696 0.02% 52 2594 0.02% 53 2783 0.02% 54 2817 0.03% 55 2957 0.03% 56 3016 0.03% 57 3248 0.03% 58 3173 0.03% 59 3401 0.03% 60 3545 0.03% 61 3610 0.03% 62 3847 0.03% 63 3894 0.03% 64 3766 0.03% 65 3810 0.03% 66 4056 0.04% 67 4058 0.04% 68 5069 0.05% 69 4932 0.04% 70 4998 0.04% 71 4563 0.04% 72 4488 0.04% 73 4656 0.04% 74 4790 0.04% 75 5013 0.04% 76 3545 0.03% 77 4040 0.04% 78 4459 0.04% 79 4943 0.04% 80 5098 0.05% 81 5313 0.05% 82 5872 0.05% 83 6418 0.06% 84 6792 0.06% 85 6923 0.06% 86 7458 0.07% 87 8202 0.07% 88 8789 0.08% 89 9551 0.09% 90 10692 0.10% 91 11743 0.10% 92 13371 0.12% 93 15044 0.13% 94 17525 0.16% 95 20280 0.18% 96 24165 0.22% 97 28119 0.25% 98 32799 0.29% 99 33693 0.30% 100 10745066 96.07% 11184697 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=35.72 fanout-score-rank=8 prefix-density=0.28 prefix-fanout=29.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=351.58 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=16.3 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAG Started job on | Feb 11 21:26:36 Started mapping on | Feb 11 21:26:36 Finished on | Feb 11 21:26:51 Mapping speed, Million of reads per hour | 2684.33 Number of input reads | 11184697 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10739693 Uniquely mapped reads % | 96.02% Average mapped length | 98.99 Number of splices: Total | 3181906 Number of splices: Annotated (sjdb) | 3123624 Number of splices: GT/AG | 3134893 Number of splices: GC/AG | 38817 Number of splices: AT/AC | 3133 Number of splices: Non-canonical | 5063 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230153 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 35503 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 214851 214851 214851 N_multimapping 230153 230153 230153 N_noFeature 484158 5547941 5604090 N_ambiguous 108207 18237 18280 UnstrandedReadsAssigned:10147328 PositiveStrandReadsAssigned:5173515 NegativeStrandReadsAssigned:5117323 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207964 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207964-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,184,697 reads, 10,369,785 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR3207964.ke.tsv 34699 SRR3207964.se.tsv 87100 total ==> SRR3207964.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 319 24.1114 Potri.005G024800.1.v4.1 1035 936 42 6.50849 Potri.004G059700.1.v4.1 961 862 7 1.17787 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 148.191 7.55788 Potri.016G087400.1.v4.1 270 171 420 356.254 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 3.20592 Potri.012G127500.1.v4.1 977 878 1076 177.756 ==> SRR3207964.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1168 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207964 completed mapping pipeline successfully