Starting /dee2/code/volunteer_pipeline.sh SRR3207966 current disk space = 3052886020096 free memory = 1494568528 SRR3207966 SRAfilesize 1ab2716caacb46e280d54d6870a29102 SRR3207966.sra SRR3207966.sra file validated SRR3207966 is single end SRR3207966 is conventional basespace SRR3207966 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207966_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92675 34.0 31.0 34.0 31.0 34.0 2 33.122 34.0 33.0 34.0 31.0 34.0 3 33.29125 34.0 34.0 34.0 31.0 34.0 4 36.47475 37.0 37.0 37.0 35.0 37.0 5 36.36525 37.0 37.0 37.0 35.0 37.0 6 36.43675 37.0 37.0 37.0 35.0 37.0 7 36.42375 37.0 37.0 37.0 35.0 37.0 8 36.48 37.0 37.0 37.0 35.0 37.0 9 38.2445 39.0 39.0 39.0 37.0 39.0 10-11 38.25775 39.0 39.0 39.0 37.0 39.0 12-13 38.276624999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.957125000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.95525 41.0 40.0 41.0 38.0 41.0 18-19 39.904624999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.87925 41.0 40.0 41.0 38.0 41.0 22-23 39.537499999999994 41.0 40.0 41.0 36.5 41.0 24-25 39.77775 41.0 40.0 41.0 38.0 41.0 26-27 39.751625000000004 41.0 40.0 41.0 38.0 41.0 28-29 39.703375 41.0 40.0 41.0 37.5 41.0 30-31 39.607875 41.0 40.0 41.0 37.0 41.0 32-33 39.275625000000005 41.0 40.0 41.0 36.0 41.0 34-35 39.422125 41.0 40.0 41.0 37.0 41.0 36-37 39.34975 41.0 39.0 41.0 37.0 41.0 38-39 39.287 41.0 39.0 41.0 36.0 41.0 40-41 39.103875 40.0 39.0 41.0 36.0 41.0 42-43 39.273125 41.0 39.0 41.0 36.5 41.0 44-45 39.292249999999996 41.0 39.0 41.0 36.0 41.0 46-47 39.188500000000005 41.0 39.0 41.0 36.0 41.0 48-49 38.96575 40.0 39.0 41.0 35.0 41.0 50-51 39.233000000000004 41.0 39.0 41.0 36.0 41.0 52-53 39.258875 41.0 39.0 41.0 36.0 41.0 54-55 39.021 41.0 39.0 41.0 35.0 41.0 56-57 38.83325 41.0 39.0 41.0 35.0 41.0 58-59 38.537625 40.5 38.0 41.0 35.0 41.0 60-61 38.4775 40.0 38.0 41.0 35.0 41.0 62-63 38.37075 40.0 37.0 41.0 35.0 41.0 64-65 38.095124999999996 39.5 37.0 41.0 34.5 41.0 66-67 37.7265 39.0 36.0 41.0 34.0 41.0 68-69 37.30525 39.0 36.0 41.0 34.0 41.0 70-71 36.911125 38.0 35.0 40.0 34.0 41.0 72-73 36.19225 37.0 35.0 39.0 33.0 41.0 74-75 35.688625 37.0 35.0 39.0 33.0 41.0 76-77 34.791624999999996 36.0 34.5 37.5 31.5 39.0 78-79 34.793125 36.0 35.0 37.0 32.0 39.0 80-81 34.46 35.0 35.0 37.0 31.5 39.0 82-83 34.219875 35.0 35.0 36.5 32.0 37.0 84-85 33.96275 35.0 35.0 36.0 31.5 37.0 86-87 33.777375 35.0 35.0 36.0 32.0 37.0 88-89 33.2085 35.0 34.0 35.0 30.0 36.0 90-91 33.276125 35.0 34.0 35.0 31.0 36.0 92-93 33.18725 35.0 34.0 35.0 31.0 36.0 94-95 33.14975 35.0 34.0 35.0 31.0 36.0 96-97 33.074375 35.0 34.0 35.0 31.0 35.5 98-99 32.983875 35.0 34.0 35.0 31.0 35.0 100 32.859 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 1.0 15 0.0 16 3.0 17 6.0 18 4.0 19 6.0 20 4.0 21 2.0 22 7.0 23 5.0 24 7.0 25 10.0 26 13.0 27 30.0 28 43.0 29 25.0 30 34.0 31 43.0 32 49.0 33 74.0 34 86.0 35 154.0 36 253.0 37 757.0 38 1718.0 39 658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.075 16.475 16.125 41.325 2 19.1 24.7 38.074999999999996 18.125 3 20.724999999999998 26.950000000000003 30.3 22.025 4 23.275000000000002 33.300000000000004 20.525 22.900000000000002 5 24.45 34.925 22.475 18.15 6 19.675 37.25 24.025 19.05 7 15.675 18.825 43.8 21.7 8 18.3 24.875 28.875 27.950000000000003 9 21.224999999999998 23.549999999999997 30.049999999999997 25.174999999999997 10-11 22.625 33.9625 22.775000000000002 20.6375 12-13 19.6875 27.075 30.562499999999996 22.675 14-15 21.2375 28.325 28.499999999999996 21.9375 16-17 21.45 28.349999999999998 27.3875 22.8125 18-19 20.7125 27.6875 28.825 22.775000000000002 20-21 21.7375 28.95 27.8125 21.5 22-23 20.2125 30.4 28.275 21.1125 24-25 21.352669083635455 28.678584823102888 27.790973871733964 22.177772221527693 26-27 20.7375 28.1875 28.175 22.900000000000002 28-29 21.395523321245467 29.223458797048895 27.38526947605352 21.99574840565212 30-31 20.610305152576288 27.688844422211105 28.951975987994 22.748874437218607 32-33 21.087500000000002 29.037499999999998 28.499999999999996 21.375 34-35 21.6125 28.475 28.000000000000004 21.912499999999998 36-37 21.375 29.099999999999998 28.475 21.05 38-39 21.85 28.212500000000002 28.3625 21.575 40-41 21.475 28.325 28.075 22.125 42-43 21.1375 29.037499999999998 28.1 21.725 44-45 21.5375 27.55 28.8375 22.075 46-47 22.425 27.0875 27.8375 22.650000000000002 48-49 21.3625 28.449999999999996 27.975 22.2125 50-51 23.0875 27.325 28.349999999999998 21.2375 52-53 21.9625 27.537499999999998 27.3625 23.1375 54-55 21.525 28.012500000000003 28.95 21.512500000000003 56-57 22.1 27.625 28.975 21.3 58-59 21.525 28.325 28.5625 21.587500000000002 60-61 22.112499999999997 28.425 28.7375 20.724999999999998 62-63 20.95 29.1875 27.987499999999997 21.875 64-65 21.7 28.1375 28.4 21.762500000000003 66-67 20.9125 30.4 27.200000000000003 21.4875 68-69 21.65 29.375 27.625 21.349999999999998 70-71 21.837500000000002 28.999999999999996 27.987499999999997 21.175 72-73 20.6625 29.625 28.6375 21.075 74-75 21.7 29.4125 27.375 21.512500000000003 76-77 21.55 29.325000000000003 27.1125 22.0125 78-79 21.65 28.499999999999996 27.55 22.3 80-81 21.65 29.3875 27.200000000000003 21.762500000000003 82-83 21.7 28.9125 27.1125 22.275 84-85 21.3875 28.525 28.65 21.4375 86-87 22.5125 27.5625 28.787499999999998 21.1375 88-89 22.1375 27.6375 28.725 21.5 90-91 22.55 28.475 27.487499999999997 21.4875 92-93 22.3625 28.237499999999997 28.449999999999996 20.95 94-95 21.5375 28.675 28.199999999999996 21.587500000000002 96-97 21.5 28.475 27.787499999999998 22.237499999999997 98-99 22.15 28.1125 28.212500000000002 21.525 100 21.099999999999998 28.599999999999998 28.299999999999997 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 6.0 27 8.5 28 8.5 29 15.5 30 28.0 31 32.5 32 37.5 33 51.0 34 63.5 35 80.5 36 98.0 37 121.5 38 151.5 39 181.5 40 211.0 41 231.0 42 247.5 43 276.0 44 275.0 45 265.0 46 261.0 47 234.5 48 215.0 49 183.0 50 145.5 51 133.5 52 106.0 53 68.0 54 54.0 55 46.0 56 39.0 57 28.0 58 19.5 59 14.0 60 10.5 61 10.5 62 8.5 63 5.5 64 4.0 65 2.5 66 1.5 67 0.5 68 0.5 69 2.5 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0375 30-31 0.05 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.66979933959867 98.1 2 0.27940055880111764 0.5499999999999999 3 0.0 0.0 4 0.025400050800101596 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025400050800101596 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 50 1.25 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814718 spots for SRR3207966.sra Written 814718 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra Read 814704 spots for SRR3207966.sra Written 814704 spots for SRR3207966.sra SRR ids: ['SRR3207966.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d7xc30zd SRR3207966.sra spots: 16294094 blocks: [[1, 814704], [814705, 1629408], [1629409, 2444112], [2444113, 3258816], [3258817, 4073520], [4073521, 4888224], [4888225, 5702928], [5702929, 6517632], [6517633, 7332336], [7332337, 8147040], [8147041, 8961744], [8961745, 9776448], [9776449, 10591152], [10591153, 11405856], [11405857, 12220560], [12220561, 13035264], [13035265, 13849968], [13849969, 14664672], [14664673, 15479376], [15479377, 16294094]] SRR3207966 file size 4229562 SRR3207966 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207966 SRR3207966_1.fastq Input file: SRR3207966_1.fastq trimmed: SRR3207966-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:18:25 2025 >> started Tue Feb 11 21:18:32 2025 >> done (7.121s) 16294094 reads processed; of these: 2283 ( 0.01%) short reads filtered out after trimming by size control 319564 ( 1.96%) empty reads filtered out after trimming by size control 15972247 (98.02%) reads available; of these: 700694 ( 4.39%) trimmed reads available after processing 15271553 (95.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 346 0.00% 19 576 0.00% 20 1334 0.01% 21 716 0.00% 22 831 0.01% 23 1075 0.01% 24 1478 0.01% 25 1952 0.01% 26 2291 0.01% 27 2196 0.01% 28 2303 0.01% 29 2408 0.02% 30 2297 0.01% 31 2436 0.02% 32 3101 0.02% 33 2621 0.02% 34 2701 0.02% 35 2627 0.02% 36 2956 0.02% 37 3025 0.02% 38 3299 0.02% 39 3296 0.02% 40 3319 0.02% 41 3326 0.02% 42 3776 0.02% 43 3475 0.02% 44 3717 0.02% 45 3650 0.02% 46 3817 0.02% 47 3940 0.02% 48 4551 0.03% 49 4339 0.03% 50 4956 0.03% 51 4453 0.03% 52 4612 0.03% 53 4963 0.03% 54 5417 0.03% 55 5222 0.03% 56 5885 0.04% 57 5877 0.04% 58 6706 0.04% 59 6762 0.04% 60 7101 0.04% 61 6784 0.04% 62 7144 0.04% 63 6903 0.04% 64 7441 0.05% 65 8391 0.05% 66 6800 0.04% 67 7020 0.04% 68 7341 0.05% 69 6882 0.04% 70 8674 0.05% 71 11047 0.07% 72 9345 0.06% 73 8176 0.05% 74 8089 0.05% 75 7736 0.05% 76 5569 0.03% 77 6239 0.04% 78 6767 0.04% 79 7548 0.05% 80 7919 0.05% 81 8354 0.05% 82 8829 0.06% 83 10063 0.06% 84 10108 0.06% 85 10741 0.07% 86 11297 0.07% 87 12056 0.08% 88 13033 0.08% 89 14608 0.09% 90 15920 0.10% 91 17513 0.11% 92 19766 0.12% 93 22300 0.14% 94 25782 0.16% 95 29410 0.18% 96 35928 0.22% 97 41845 0.26% 98 47573 0.30% 99 48024 0.30% 100 15271553 95.61% 15972247 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=37.68 fanout-score-rank=9 prefix-density=0.32 prefix-fanout=30.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=303.27 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.9 sequence=TTCTTCTTCTTTT Started job on | Feb 11 21:18:49 Started mapping on | Feb 11 21:18:49 Finished on | Feb 11 21:19:07 Mapping speed, Million of reads per hour | 3194.45 Number of input reads | 15972247 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15226827 Uniquely mapped reads % | 95.33% Average mapped length | 98.91 Number of splices: Total | 4378005 Number of splices: Annotated (sjdb) | 4289573 Number of splices: GT/AG | 4308711 Number of splices: GC/AG | 56732 Number of splices: AT/AC | 4764 Number of splices: Non-canonical | 7798 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340016 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 95566 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405404 405404 405404 N_multimapping 340016 340016 340016 N_noFeature 787637 7912414 7985000 N_ambiguous 173962 28246 28913 UnstrandedReadsAssigned:14265228 PositiveStrandReadsAssigned:7286167 NegativeStrandReadsAssigned:7212914 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207966 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207966-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,972,247 reads, 14,636,957 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR3207966.ke.tsv 34699 SRR3207966.se.tsv 87100 total ==> SRR3207966.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 586 30.7085 Potri.005G024800.1.v4.1 1035 936 149 16.0083 Potri.004G059700.1.v4.1 961 862 24 2.79988 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 272.715 9.64307 Potri.016G087400.1.v4.1 270 171 528 310.509 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 50.4061 3.02805 Potri.012G127500.1.v4.1 977 878 983 112.589 ==> SRR3207966.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1981 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 36 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR3207966 completed mapping pipeline successfully