Starting /dee2/code/volunteer_pipeline.sh SRR3207967 current disk space = 3053032710144 free memory = 1411201272 SRR3207967 SRAfilesize 38ea83cd5181363148687af08cac0e55 SRR3207967.sra SRR3207967.sra file validated SRR3207967 is single end SRR3207967 is conventional basespace SRR3207967 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207967_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.996 34.0 31.0 34.0 31.0 34.0 2 33.14325 34.0 33.0 34.0 31.0 34.0 3 33.21 34.0 34.0 34.0 31.0 34.0 4 36.4685 37.0 37.0 37.0 35.0 37.0 5 36.40225 37.0 37.0 37.0 35.0 37.0 6 36.36325 37.0 37.0 37.0 35.0 37.0 7 36.38175 37.0 37.0 37.0 35.0 37.0 8 36.385 37.0 37.0 37.0 35.0 37.0 9 38.22725 39.0 39.0 39.0 37.0 39.0 10-11 38.186125000000004 39.0 39.0 39.0 37.0 39.0 12-13 37.799625000000006 39.0 38.5 39.0 36.0 39.0 14-15 39.758375 41.0 40.0 41.0 37.0 41.0 16-17 39.7755 41.0 40.0 41.0 38.0 41.0 18-19 39.639125 41.0 40.0 41.0 37.0 41.0 20-21 39.738125 41.0 40.0 41.0 37.0 41.0 22-23 39.759375000000006 41.0 40.0 41.0 37.5 41.0 24-25 39.674625 41.0 40.0 41.0 37.5 41.0 26-27 39.64775 41.0 40.0 41.0 37.0 41.0 28-29 39.45675 41.0 40.0 41.0 37.0 41.0 30-31 39.333375000000004 41.0 39.5 41.0 37.0 41.0 32-33 39.29125 41.0 39.5 41.0 36.0 41.0 34-35 39.216625 41.0 39.0 41.0 36.0 41.0 36-37 39.201125000000005 41.0 39.0 41.0 36.0 41.0 38-39 39.1365 41.0 39.0 41.0 36.0 41.0 40-41 38.933125000000004 40.5 39.0 41.0 35.5 41.0 42-43 38.977375 40.5 39.0 41.0 35.0 41.0 44-45 38.650999999999996 40.5 38.5 41.0 34.5 41.0 46-47 38.834999999999994 40.0 39.0 41.0 35.0 41.0 48-49 38.85625 41.0 39.0 41.0 35.0 41.0 50-51 38.973875 41.0 39.0 41.0 35.0 41.0 52-53 38.991125 41.0 39.0 41.0 35.0 41.0 54-55 38.596500000000006 41.0 38.5 41.0 34.5 41.0 56-57 38.630875 40.5 38.5 41.0 35.0 41.0 58-59 38.422875000000005 40.0 38.0 41.0 34.5 41.0 60-61 38.367875 40.0 37.5 41.0 35.0 41.0 62-63 37.97325 40.0 37.0 41.0 34.0 41.0 64-65 37.640125 39.0 36.5 41.0 34.0 41.0 66-67 37.34075 39.0 36.0 41.0 33.5 41.0 68-69 36.97 39.0 35.5 40.5 34.0 41.0 70-71 36.577375 37.0 35.0 39.5 33.0 41.0 72-73 35.859875 37.0 35.0 39.0 32.0 41.0 74-75 35.498875 36.5 35.0 39.0 32.0 40.5 76-77 34.5215 35.5 34.0 37.0 31.0 39.0 78-79 34.616625 35.5 35.0 37.0 31.0 39.0 80-81 34.379875 35.0 35.0 37.0 32.0 39.0 82-83 34.077124999999995 35.0 35.0 36.0 31.0 37.0 84-85 33.85875 35.0 35.0 36.0 31.0 37.0 86-87 33.602374999999995 35.0 35.0 36.0 31.0 36.5 88-89 33.384874999999994 35.0 34.0 35.0 31.0 36.0 90-91 33.1265 35.0 34.0 35.0 31.0 36.0 92-93 32.811499999999995 35.0 34.0 35.0 29.5 36.0 94-95 32.89875 35.0 34.0 35.0 30.5 35.5 96-97 32.75875 35.0 34.0 35.0 30.0 35.0 98-99 32.685874999999996 35.0 34.0 35.0 30.0 35.0 100 32.61375 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 2.0 9 0.0 10 6.0 11 1.0 12 3.0 13 2.0 14 5.0 15 5.0 16 3.0 17 5.0 18 2.0 19 3.0 20 4.0 21 3.0 22 5.0 23 8.0 24 8.0 25 14.0 26 23.0 27 19.0 28 44.0 29 47.0 30 27.0 31 40.0 32 61.0 33 66.0 34 98.0 35 153.0 36 286.0 37 761.0 38 1761.0 39 532.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.250000000000004 15.75 14.475 42.525 2 18.875 24.325 37.574999999999996 19.225 3 20.75 27.250000000000004 28.599999999999998 23.400000000000002 4 22.85 34.0 21.025 22.125 5 24.037018509254626 35.91795897948975 21.660830415207606 18.384192096048025 6 18.375 37.275000000000006 24.625 19.725 7 16.075 17.8 43.925 22.2 8 18.35 23.325000000000003 30.775000000000002 27.55 9 20.05 23.849999999999998 30.049999999999997 26.05 10-11 22.412499999999998 33.0625 22.5125 22.0125 12-13 20.4 26.150000000000002 30.7 22.75 14-15 21.2625 27.6875 28.849999999999998 22.2 16-17 22.162499999999998 28.7 26.650000000000002 22.4875 18-19 20.9375 28.262500000000003 28.025 22.775000000000002 20-21 21.375 28.549999999999997 28.537499999999998 21.5375 22-23 21.575 29.175 27.6875 21.5625 24-25 20.80520130032508 28.95723930982746 29.107276819204802 21.13028257064266 26-27 21.512500000000003 28.349999999999998 27.6625 22.475 28-29 22.337629833562758 28.13164810411713 27.230634463771743 22.30008759854837 30-31 21.43929912390488 27.04630788485607 28.448060075093867 23.066332916145182 32-33 21.087500000000002 27.9125 28.512500000000003 22.4875 34-35 21.6625 28.787499999999998 27.800000000000004 21.75 36-37 21.462500000000002 27.3875 27.237499999999997 23.9125 38-39 21.75 27.474999999999998 27.525 23.25 40-41 20.8875 29.349999999999998 27.575 22.1875 42-43 22.375 28.499999999999996 27.224999999999998 21.9 44-45 21.3875 29.375 27.750000000000004 21.4875 46-47 21.837500000000002 27.700000000000003 27.800000000000004 22.662499999999998 48-49 20.6125 28.8375 28.712500000000002 21.837500000000002 50-51 21.925 28.075 28.425 21.575 52-53 21.8 27.85 28.199999999999996 22.15 54-55 21.1625 28.349999999999998 29.15 21.337500000000002 56-57 21.2625 27.712500000000002 28.249999999999996 22.775000000000002 58-59 20.7875 28.1875 28.025 23.0 60-61 22.162499999999998 28.0875 27.825 21.925 62-63 21.4375 27.925 28.449999999999996 22.1875 64-65 22.475 27.6625 28.075 21.7875 66-67 21.925 28.575 28.175 21.325 68-69 21.625 28.487499999999997 28.199999999999996 21.6875 70-71 22.2625 27.8125 28.1875 21.7375 72-73 21.5375 28.8875 27.85 21.725 74-75 22.125 28.975 27.150000000000002 21.75 76-77 22.025 28.9875 27.474999999999998 21.512500000000003 78-79 22.5 27.975 27.625 21.9 80-81 21.175 29.2375 27.8875 21.7 82-83 22.15 28.625 27.9125 21.3125 84-85 21.825 28.6375 27.762500000000003 21.775 86-87 21.7 28.425 28.5875 21.2875 88-89 22.287499999999998 28.762500000000003 27.3125 21.637500000000003 90-91 21.6625 28.7 27.4125 22.225 92-93 21.65 27.775 28.3125 22.2625 94-95 22.5625 28.999999999999996 27.287499999999998 21.15 96-97 22.0625 28.8625 27.712500000000002 21.3625 98-99 22.1 28.762500000000003 27.3 21.837500000000002 100 21.349999999999998 29.075 26.924999999999997 22.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.5 24 3.5 25 2.0 26 3.0 27 7.5 28 8.0 29 9.5 30 20.5 31 27.0 32 41.0 33 50.5 34 63.0 35 82.0 36 86.5 37 112.0 38 145.0 39 173.0 40 193.5 41 210.0 42 230.0 43 257.0 44 272.5 45 270.5 46 265.0 47 259.5 48 239.0 49 208.0 50 174.0 51 134.5 52 114.5 53 89.5 54 63.5 55 41.0 56 28.5 57 26.0 58 18.5 59 16.0 60 12.0 61 6.5 62 8.5 63 6.5 64 1.5 65 2.0 66 2.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.11249999999999999 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72194135490395 98.625 2 0.1769464105156724 0.35000000000000003 3 0.05055611729019212 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05055611729019212 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 25 0.625 TruSeq Adapter, Index 18 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTA 10 0.25 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.3 0.0 0.0 0.0 0.0 2 0.3 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.3 0.0 0.0 0.0 0.0 5 0.3 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.3 0.0 0.0 0.0 0.0 8 0.3 0.0 0.0 0.0 0.0 9 0.3 0.0 0.0 0.0 0.0 10-11 0.3 0.0 0.0 0.0 0.0 12-13 0.3 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.3 0.0 0.0 0.0 0.0 18-19 0.3 0.0 0.0 0.0 0.0 20-21 0.3 0.0 0.0 0.0 0.0 22-23 0.3 0.0 0.0 0.0 0.0 24-25 0.3 0.0 0.0 0.0 0.0 26-27 0.3 0.0 0.0 0.0 0.0 28-29 0.3125 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.325 0.0 0.0 0.0 0.0 34-35 0.325 0.0 0.0 0.0 0.0 36-37 0.325 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.35 0.0 0.0 0.0 0.0 46-47 0.35 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.375 0.0 0.0 0.0 0.0 52-53 0.4 0.0 0.0 0.0 0.0 54-55 0.4 0.0 0.0 0.0 0.0 56-57 0.4 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.425 0.0 0.0 0.0 0.0 64-65 0.425 0.0 0.0 0.0 0.0 66-67 0.425 0.0 0.0 0.0 0.0 68-69 0.425 0.0 0.0 0.0 0.0 70-71 0.45 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.7124999999999999 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra Read 815681 spots for SRR3207967.sra Written 815681 spots for SRR3207967.sra Read 815667 spots for SRR3207967.sra Written 815667 spots for SRR3207967.sra SRR ids: ['SRR3207967.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vc51ztvu SRR3207967.sra spots: 16313354 blocks: [[1, 815667], [815668, 1631334], [1631335, 2447001], [2447002, 3262668], [3262669, 4078335], [4078336, 4894002], [4894003, 5709669], [5709670, 6525336], [6525337, 7341003], [7341004, 8156670], [8156671, 8972337], [8972338, 9788004], [9788005, 10603671], [10603672, 11419338], [11419339, 12235005], [12235006, 13050672], [13050673, 13866339], [13866340, 14682006], [14682007, 15497673], [15497674, 16313354]] SRR3207967 file size 4234603 SRR3207967 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207967 SRR3207967_1.fastq Input file: SRR3207967_1.fastq trimmed: SRR3207967-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:06:56 2025 >> started Tue Feb 11 21:07:04 2025 >> done (7.853s) 16313354 reads processed; of these: 2997 ( 0.02%) short reads filtered out after trimming by size control 227444 ( 1.39%) empty reads filtered out after trimming by size control 16082913 (98.59%) reads available; of these: 691807 ( 4.30%) trimmed reads available after processing 15391106 (95.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 468 0.00% 19 520 0.00% 20 620 0.00% 21 784 0.00% 22 969 0.01% 23 1294 0.01% 24 1721 0.01% 25 2115 0.01% 26 2172 0.01% 27 2256 0.01% 28 2205 0.01% 29 2471 0.02% 30 2612 0.02% 31 2438 0.02% 32 2704 0.02% 33 2770 0.02% 34 2585 0.02% 35 2680 0.02% 36 2815 0.02% 37 2839 0.02% 38 2804 0.02% 39 3171 0.02% 40 3263 0.02% 41 3689 0.02% 42 3393 0.02% 43 3328 0.02% 44 3374 0.02% 45 3596 0.02% 46 3708 0.02% 47 3660 0.02% 48 3907 0.02% 49 4107 0.03% 50 3951 0.02% 51 4165 0.03% 52 4798 0.03% 53 4574 0.03% 54 4633 0.03% 55 4863 0.03% 56 5275 0.03% 57 5496 0.03% 58 5657 0.04% 59 5644 0.04% 60 5752 0.04% 61 6093 0.04% 62 6198 0.04% 63 6288 0.04% 64 6696 0.04% 65 7215 0.04% 66 6851 0.04% 67 7354 0.05% 68 7772 0.05% 69 6634 0.04% 70 7891 0.05% 71 11266 0.07% 72 8817 0.05% 73 7768 0.05% 74 7842 0.05% 75 7739 0.05% 76 5496 0.03% 77 6095 0.04% 78 6822 0.04% 79 7289 0.05% 80 7757 0.05% 81 8465 0.05% 82 9041 0.06% 83 9958 0.06% 84 10290 0.06% 85 10811 0.07% 86 11493 0.07% 87 12155 0.08% 88 13153 0.08% 89 14497 0.09% 90 16052 0.10% 91 17915 0.11% 92 19794 0.12% 93 22444 0.14% 94 26697 0.17% 95 30614 0.19% 96 36234 0.23% 97 42763 0.27% 98 47781 0.30% 99 49921 0.31% 100 15391106 95.70% 16082913 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=53.53 fanout-score-rank=5 prefix-density=0.69 prefix-fanout=38.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=200.20 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=23.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 21:07:22 Started mapping on | Feb 11 21:07:22 Finished on | Feb 11 21:07:41 Mapping speed, Million of reads per hour | 3047.29 Number of input reads | 16082913 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15281797 Uniquely mapped reads % | 95.02% Average mapped length | 98.85 Number of splices: Total | 4510227 Number of splices: Annotated (sjdb) | 4427680 Number of splices: GT/AG | 4441942 Number of splices: GC/AG | 55904 Number of splices: AT/AC | 4770 Number of splices: Non-canonical | 7611 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339110 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 62583 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 462006 462006 462006 N_multimapping 339110 339110 339110 N_noFeature 662657 7869851 7958205 N_ambiguous 170522 26906 27462 UnstrandedReadsAssigned:14448618 PositiveStrandReadsAssigned:7385040 NegativeStrandReadsAssigned:7296130 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207967 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207967-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,082,913 reads, 14,796,933 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR3207967.ke.tsv 34699 SRR3207967.se.tsv 87100 total ==> SRR3207967.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 464 24.0452 Potri.005G024800.1.v4.1 1035 936 87 9.24332 Potri.004G059700.1.v4.1 961 862 13 1.49976 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 200.259 7.0024 Potri.016G087400.1.v4.1 270 171 593 344.86 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 49 2.91089 Potri.012G127500.1.v4.1 977 878 1347 152.566 ==> SRR3207967.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1500 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 66 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207967 completed mapping pipeline successfully