Starting /dee2/code/volunteer_pipeline.sh SRR3207968 current disk space = 3052909490176 free memory = 1424260324 SRR3207968 SRAfilesize 86e2fe30960bca9a3f76c77aab062272 SRR3207968.sra SRR3207968.sra file validated SRR3207968 is single end SRR3207968 is conventional basespace SRR3207968 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207968_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1005 34.0 33.0 34.0 31.0 34.0 2 33.21275 34.0 34.0 34.0 31.0 34.0 3 33.26575 34.0 34.0 34.0 31.0 34.0 4 36.52925 37.0 37.0 37.0 35.0 37.0 5 36.4435 37.0 37.0 37.0 35.0 37.0 6 36.40675 37.0 37.0 37.0 35.0 37.0 7 36.4585 37.0 37.0 37.0 35.0 37.0 8 36.43775 37.0 37.0 37.0 35.0 37.0 9 38.30175 39.0 39.0 39.0 37.0 39.0 10-11 38.233875 39.0 39.0 39.0 37.0 39.0 12-13 37.95 39.0 38.5 39.0 36.0 39.0 14-15 39.838499999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.847375 41.0 40.0 41.0 38.0 41.0 18-19 39.6655 41.0 40.0 41.0 37.5 41.0 20-21 39.79975 41.0 40.0 41.0 38.0 41.0 22-23 39.8095 41.0 40.0 41.0 38.0 41.0 24-25 39.7785 41.0 40.0 41.0 38.0 41.0 26-27 39.740875 41.0 40.0 41.0 37.5 41.0 28-29 39.584 41.0 40.0 41.0 37.0 41.0 30-31 39.4525 41.0 40.0 41.0 37.0 41.0 32-33 39.42475 41.0 40.0 41.0 37.0 41.0 34-35 39.372125 41.0 40.0 41.0 36.5 41.0 36-37 39.333125 41.0 39.5 41.0 36.0 41.0 38-39 39.252875 41.0 39.0 41.0 36.0 41.0 40-41 39.032 41.0 39.0 41.0 35.5 41.0 42-43 39.131375 41.0 39.0 41.0 35.5 41.0 44-45 38.837 40.5 38.5 41.0 35.0 41.0 46-47 39.007875 41.0 39.0 41.0 35.0 41.0 48-49 38.98725 41.0 39.0 41.0 35.0 41.0 50-51 39.158874999999995 41.0 39.0 41.0 36.0 41.0 52-53 39.2055 41.0 39.0 41.0 36.0 41.0 54-55 38.909625 41.0 39.0 41.0 35.0 41.0 56-57 38.88475 41.0 39.0 41.0 35.0 41.0 58-59 38.60975 40.5 38.0 41.0 35.0 41.0 60-61 38.481750000000005 40.0 38.0 41.0 35.0 41.0 62-63 38.2175 40.0 37.0 41.0 34.5 41.0 64-65 37.926125 39.5 37.0 41.0 34.0 41.0 66-67 37.6105 39.0 36.0 41.0 34.0 41.0 68-69 37.225375 39.0 35.5 41.0 34.0 41.0 70-71 36.753874999999994 37.5 35.0 40.0 33.0 41.0 72-73 36.179874999999996 37.0 35.0 39.0 33.0 41.0 74-75 35.814375 36.5 35.0 39.0 33.0 41.0 76-77 34.830875 36.0 34.5 37.0 31.5 39.0 78-79 34.849000000000004 36.0 35.0 37.0 32.0 39.0 80-81 34.599125 35.0 35.0 37.0 32.0 39.0 82-83 34.290875 35.0 35.0 36.0 32.0 37.0 84-85 34.12 35.0 35.0 36.0 32.0 37.0 86-87 33.877875 35.0 35.0 36.0 32.0 37.0 88-89 33.597625 35.0 35.0 35.0 32.0 36.0 90-91 33.30675 35.0 34.0 35.0 31.0 36.0 92-93 33.037 35.0 34.0 35.0 29.5 36.0 94-95 33.139625 35.0 34.0 35.0 31.0 36.0 96-97 33.034 35.0 34.0 35.0 31.0 35.0 98-99 32.952749999999995 35.0 34.0 35.0 31.0 35.0 100 32.90025 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 4.0 11 3.0 12 1.0 13 2.0 14 0.0 15 2.0 16 2.0 17 3.0 18 6.0 19 4.0 20 5.0 21 8.0 22 12.0 23 7.0 24 10.0 25 13.0 26 15.0 27 24.0 28 36.0 29 25.0 30 29.0 31 45.0 32 46.0 33 62.0 34 78.0 35 149.0 36 270.0 37 721.0 38 1785.0 39 630.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.424999999999997 16.6 13.55 43.425000000000004 2 18.825 24.725 39.425 17.025000000000002 3 20.150000000000002 28.025 29.15 22.675 4 21.875 34.050000000000004 20.724999999999998 23.35 5 23.380845211302827 36.00900225056264 23.705926481620406 16.90422605651413 6 18.05 37.375 25.124999999999996 19.45 7 16.225 18.95 44.224999999999994 20.599999999999998 8 18.3 23.575 31.25 26.875 9 20.025000000000002 22.85 32.0 25.124999999999996 10-11 21.675 34.025 22.75 21.55 12-13 20.1375 26.125 30.6875 23.05 14-15 20.837500000000002 28.199999999999996 28.9 22.0625 16-17 21.2625 28.125 27.5625 23.05 18-19 21.3875 28.537499999999998 28.212500000000002 21.8625 20-21 22.775000000000002 27.8125 27.825 21.587500000000002 22-23 21.2375 30.1875 27.275 21.3 24-25 20.325 29.175 28.199999999999996 22.3 26-27 20.925 28.775000000000002 27.85 22.45 28-29 22.411205602801402 28.88944472236118 27.01350675337669 21.68584292146073 30-31 21.463414634146343 28.180112570356474 28.430268918073796 21.92620387742339 32-33 20.7 29.4375 27.3625 22.5 34-35 22.15 28.249999999999996 28.199999999999996 21.4 36-37 21.5 28.6375 27.35 22.5125 38-39 21.762500000000003 28.7375 27.875 21.625 40-41 21.2625 29.0875 27.0125 22.6375 42-43 21.4375 29.2875 28.0625 21.212500000000002 44-45 22.2625 28.775000000000002 28.1375 20.825 46-47 22.287499999999998 27.9375 27.975 21.8 48-49 21.6125 28.487499999999997 28.212500000000002 21.6875 50-51 22.112499999999997 28.749999999999996 27.5625 21.575 52-53 22.0 29.049999999999997 26.637499999999996 22.3125 54-55 20.674999999999997 29.2375 27.8125 22.275 56-57 22.025 28.0625 28.037499999999998 21.875 58-59 21.45 28.8875 28.225 21.4375 60-61 22.2625 27.650000000000002 28.475 21.6125 62-63 21.675 28.125 28.549999999999997 21.65 64-65 22.412499999999998 27.787499999999998 28.0875 21.712500000000002 66-67 21.275 28.849999999999998 28.325 21.55 68-69 21.725 28.3625 28.3125 21.6 70-71 20.724999999999998 29.425 28.3125 21.5375 72-73 21.2625 28.487499999999997 27.762500000000003 22.4875 74-75 21.25 29.225 28.037499999999998 21.4875 76-77 21.85 28.725 27.9375 21.4875 78-79 22.15 28.6625 27.875 21.3125 80-81 21.1875 29.225 28.0625 21.525 82-83 21.675 28.499999999999996 28.212500000000002 21.6125 84-85 21.224999999999998 28.8625 28.299999999999997 21.6125 86-87 21.987499999999997 27.6 28.525 21.8875 88-89 20.7625 29.037499999999998 28.8375 21.3625 90-91 21.8 28.3875 28.525 21.2875 92-93 22.0875 28.1625 28.012500000000003 21.7375 94-95 21.575 29.5875 27.9375 20.9 96-97 21.45 29.225 27.187499999999996 22.1375 98-99 22.15 28.95 27.8375 21.0625 100 22.15 27.450000000000003 28.325 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 3.5 26 5.5 27 7.5 28 12.0 29 14.5 30 19.5 31 30.0 32 37.5 33 56.0 34 84.0 35 86.5 36 93.5 37 108.0 38 141.0 39 173.5 40 188.0 41 236.0 42 270.0 43 295.5 44 289.5 45 271.0 46 261.5 47 238.0 48 214.0 49 178.5 50 155.0 51 123.5 52 92.5 53 86.5 54 65.5 55 36.0 56 26.0 57 23.0 58 18.5 59 12.0 60 8.5 61 6.0 62 6.5 63 6.0 64 2.5 65 1.5 66 2.0 67 1.5 68 1.0 69 1.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.05 30-31 0.0625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79838709677419 99.0 2 0.17641129032258063 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025201612903225805 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 26 0.65 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.1875 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88 0.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562059 spots for SRR3207968.sra Written 562059 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra Read 562053 spots for SRR3207968.sra Written 562053 spots for SRR3207968.sra SRR ids: ['SRR3207968.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iqs_y5qp SRR3207968.sra spots: 11241066 blocks: [[1, 562053], [562054, 1124106], [1124107, 1686159], [1686160, 2248212], [2248213, 2810265], [2810266, 3372318], [3372319, 3934371], [3934372, 4496424], [4496425, 5058477], [5058478, 5620530], [5620531, 6182583], [6182584, 6744636], [6744637, 7306689], [7306690, 7868742], [7868743, 8430795], [8430796, 8992848], [8992849, 9554901], [9554902, 10116954], [10116955, 10679007], [10679008, 11241066]] SRR3207968 file size 2914573 SRR3207968 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207968 SRR3207968_1.fastq Input file: SRR3207968_1.fastq trimmed: SRR3207968-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:14:29 2025 >> started Tue Feb 11 21:14:35 2025 >> done (5.530s) 11241066 reads processed; of these: 949 ( 0.01%) short reads filtered out after trimming by size control 109574 ( 0.97%) empty reads filtered out after trimming by size control 11130543 (99.02%) reads available; of these: 426976 ( 3.84%) trimmed reads available after processing 10703567 (96.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 157 0.00% 19 601 0.01% 20 2278 0.02% 21 363 0.00% 22 431 0.00% 23 613 0.01% 24 923 0.01% 25 1128 0.01% 26 1157 0.01% 27 1118 0.01% 28 1262 0.01% 29 1282 0.01% 30 1188 0.01% 31 1460 0.01% 32 1392 0.01% 33 1480 0.01% 34 1418 0.01% 35 1461 0.01% 36 1700 0.02% 37 1577 0.01% 38 1707 0.02% 39 1739 0.02% 40 1805 0.02% 41 1817 0.02% 42 1982 0.02% 43 1918 0.02% 44 2105 0.02% 45 2103 0.02% 46 2153 0.02% 47 2202 0.02% 48 2338 0.02% 49 2542 0.02% 50 2491 0.02% 51 2745 0.02% 52 2795 0.03% 53 2794 0.03% 54 2886 0.03% 55 2843 0.03% 56 3031 0.03% 57 3291 0.03% 58 3428 0.03% 59 3531 0.03% 60 3583 0.03% 61 3899 0.04% 62 3885 0.03% 63 3863 0.03% 64 4048 0.04% 65 4415 0.04% 66 4305 0.04% 67 4620 0.04% 68 4740 0.04% 69 3750 0.03% 70 4578 0.04% 71 5768 0.05% 72 5113 0.05% 73 4804 0.04% 74 4689 0.04% 75 4606 0.04% 76 3306 0.03% 77 3721 0.03% 78 4186 0.04% 79 4537 0.04% 80 4952 0.04% 81 5239 0.05% 82 5483 0.05% 83 6234 0.06% 84 6375 0.06% 85 6807 0.06% 86 7193 0.06% 87 7662 0.07% 88 8284 0.07% 89 9070 0.08% 90 10062 0.09% 91 11109 0.10% 92 12482 0.11% 93 14229 0.13% 94 16637 0.15% 95 19686 0.18% 96 23150 0.21% 97 27002 0.24% 98 30123 0.27% 99 31546 0.28% 100 10703567 96.16% 11130543 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=53.09 fanout-score-rank=8 prefix-density=0.78 prefix-fanout=37.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=295.60 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 21:14:54 Started mapping on | Feb 11 21:14:54 Finished on | Feb 11 21:15:09 Mapping speed, Million of reads per hour | 2671.33 Number of input reads | 11130543 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10559973 Uniquely mapped reads % | 94.87% Average mapped length | 98.93 Number of splices: Total | 3161429 Number of splices: Annotated (sjdb) | 3104538 Number of splices: GT/AG | 3114222 Number of splices: GC/AG | 38746 Number of splices: AT/AC | 3187 Number of splices: Non-canonical | 5274 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233155 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 186560 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 337415 337415 337415 N_multimapping 233155 233155 233155 N_noFeature 465652 5420025 5528651 N_ambiguous 112618 17965 17873 UnstrandedReadsAssigned:9981703 PositiveStrandReadsAssigned:5121983 NegativeStrandReadsAssigned:5013449 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207968 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207968-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,130,543 reads, 10,339,602 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR3207968.ke.tsv 34699 SRR3207968.se.tsv 87100 total ==> SRR3207968.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 331 24.8135 Potri.005G024800.1.v4.1 1035 936 32 4.91824 Potri.004G059700.1.v4.1 961 862 24 4.00534 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 168.172 8.50668 Potri.016G087400.1.v4.1 270 171 353 296.971 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 28 2.40624 Potri.012G127500.1.v4.1 977 878 977 160.079 ==> SRR3207968.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1168 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 34 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207968 completed mapping pipeline successfully