Starting /dee2/code/volunteer_pipeline.sh SRR3207969 current disk space = 3052621434880 free memory = 1475820300 SRR3207969 SRAfilesize 1f44c9967441cbaac3e0e408e9c616ce SRR3207969.sra SRR3207969.sra file validated SRR3207969 is single end SRR3207969 is conventional basespace SRR3207969 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207969_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.864 34.0 31.0 34.0 31.0 34.0 2 33.073 34.0 33.0 34.0 31.0 34.0 3 33.221 34.0 34.0 34.0 31.0 34.0 4 36.484 37.0 37.0 37.0 35.0 37.0 5 36.30525 37.0 37.0 37.0 35.0 37.0 6 36.319 37.0 37.0 37.0 35.0 37.0 7 36.39775 37.0 37.0 37.0 35.0 37.0 8 36.4355 37.0 37.0 37.0 35.0 37.0 9 38.159 39.0 39.0 39.0 37.0 39.0 10-11 38.214875 39.0 39.0 39.0 37.0 39.0 12-13 38.218375 39.0 39.0 39.0 37.0 39.0 14-15 39.849 41.0 40.0 41.0 38.0 41.0 16-17 39.846999999999994 41.0 40.0 41.0 38.0 41.0 18-19 39.785624999999996 41.0 40.0 41.0 37.0 41.0 20-21 39.78025 41.0 40.0 41.0 38.0 41.0 22-23 39.417249999999996 41.0 39.5 41.0 36.5 41.0 24-25 39.63975 41.0 40.0 41.0 37.0 41.0 26-27 39.557874999999996 41.0 40.0 41.0 37.0 41.0 28-29 39.506125 41.0 40.0 41.0 37.0 41.0 30-31 39.305875 41.0 40.0 41.0 37.0 41.0 32-33 38.998374999999996 41.0 39.0 41.0 36.0 41.0 34-35 39.14725 41.0 39.0 41.0 36.0 41.0 36-37 39.03275 41.0 39.0 41.0 35.0 41.0 38-39 38.91674999999999 40.5 39.0 41.0 35.0 41.0 40-41 38.651875000000004 40.0 38.5 41.0 34.5 41.0 42-43 38.75325 40.5 38.0 41.0 35.0 41.0 44-45 38.730999999999995 41.0 38.0 41.0 35.0 41.0 46-47 38.622875 40.5 38.0 41.0 35.0 41.0 48-49 38.431250000000006 40.0 38.0 41.0 34.0 41.0 50-51 38.6575 41.0 38.5 41.0 35.0 41.0 52-53 38.66974999999999 41.0 38.5 41.0 35.0 41.0 54-55 38.469125 40.5 38.0 41.0 34.5 41.0 56-57 38.152125 40.0 37.5 41.0 34.0 41.0 58-59 37.772625000000005 40.0 37.0 41.0 33.0 41.0 60-61 37.783 40.0 36.5 41.0 34.0 41.0 62-63 37.583125 39.0 36.0 41.0 34.0 41.0 64-65 37.224875 39.0 35.5 41.0 33.0 41.0 66-67 37.032125 39.0 35.0 41.0 33.0 41.0 68-69 36.606750000000005 37.5 35.0 40.5 32.5 41.0 70-71 36.115625 37.0 35.0 39.5 32.5 41.0 72-73 35.747249999999994 36.5 35.0 39.0 32.0 41.0 74-75 35.332125000000005 36.0 35.0 39.0 32.0 40.5 76-77 34.312 35.0 34.0 37.0 30.5 39.0 78-79 34.39675 35.0 35.0 37.0 31.0 39.0 80-81 34.11725 35.0 35.0 36.5 31.0 38.0 82-83 33.966375 35.0 35.0 36.0 31.0 37.0 84-85 33.737375 35.0 34.5 36.0 31.0 37.0 86-87 33.514375 35.0 34.5 35.5 31.0 36.5 88-89 32.923249999999996 35.0 34.0 35.0 29.0 36.0 90-91 33.018875 35.0 34.0 35.0 30.0 36.0 92-93 32.937250000000006 35.0 34.0 35.0 30.0 36.0 94-95 32.798249999999996 35.0 34.0 35.0 30.0 35.5 96-97 32.658125 35.0 34.0 35.0 30.0 35.0 98-99 32.496625 35.0 34.0 35.0 29.0 35.0 100 32.39875 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 5.0 10 4.0 11 2.0 12 4.0 13 2.0 14 4.0 15 4.0 16 6.0 17 5.0 18 2.0 19 6.0 20 7.0 21 6.0 22 9.0 23 5.0 24 10.0 25 10.0 26 21.0 27 26.0 28 26.0 29 39.0 30 42.0 31 49.0 32 64.0 33 87.0 34 110.0 35 176.0 36 333.0 37 786.0 38 1644.0 39 501.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.8 16.125 13.925 45.15 2 19.0 24.675 37.65 18.675 3 21.675 26.575 27.3 24.45 4 23.849999999999998 32.175 21.4 22.575 5 25.081270317579396 34.808702175543885 22.405601400350086 17.704426106526633 6 20.1 35.875 24.325 19.7 7 17.25 19.950000000000003 40.949999999999996 21.85 8 19.225 22.7 30.0 28.075 9 20.8 22.900000000000002 32.65 23.65 10-11 23.875 32.6375 21.75 21.7375 12-13 20.65 25.924999999999997 29.362500000000004 24.0625 14-15 21.175 28.6375 27.05 23.1375 16-17 22.25 28.287499999999998 26.525 22.9375 18-19 22.3125 27.787499999999998 26.637499999999996 23.2625 20-21 22.6375 27.6375 27.375 22.35 22-23 22.225 28.262500000000003 26.9625 22.55 24-25 22.400000000000002 28.199999999999996 27.287499999999998 22.112499999999997 26-27 21.6625 28.225 27.237499999999997 22.875 28-29 22.363977485928704 27.717323327079423 27.166979362101312 22.751719824890557 30-31 21.956712123107717 27.79932440885775 27.911922932565997 22.332040535468533 32-33 22.225 28.1 26.7125 22.9625 34-35 22.650000000000002 28.050000000000004 27.3 22.0 36-37 21.762500000000003 27.925 28.375 21.9375 38-39 21.987499999999997 27.5625 27.4125 23.0375 40-41 22.537499999999998 27.525 27.1625 22.775000000000002 42-43 22.3625 27.450000000000003 27.450000000000003 22.7375 44-45 22.325 27.3 27.0625 23.3125 46-47 22.25 27.487499999999997 27.35 22.912499999999998 48-49 22.575 27.737499999999997 27.700000000000003 21.987499999999997 50-51 22.3625 27.9125 26.5625 23.1625 52-53 22.375 27.1125 28.025 22.4875 54-55 22.075 27.05 28.212500000000002 22.662499999999998 56-57 22.95 26.8625 27.925 22.2625 58-59 22.5625 27.6125 27.250000000000004 22.575 60-61 23.125 26.337500000000002 27.500000000000004 23.0375 62-63 22.3625 27.712500000000002 28.075 21.85 64-65 22.8125 28.325 26.400000000000002 22.4625 66-67 22.0625 28.199999999999996 26.3 23.4375 68-69 22.9875 27.775 27.075 22.162499999999998 70-71 21.375 29.062500000000004 26.7125 22.85 72-73 21.4 27.625 27.700000000000003 23.275000000000002 74-75 22.425 27.437499999999996 27.787499999999998 22.35 76-77 22.6 28.249999999999996 27.200000000000003 21.95 78-79 22.6375 27.275 26.787499999999998 23.3 80-81 21.8125 28.6125 26.9625 22.6125 82-83 22.5625 27.925 27.4125 22.1 84-85 22.2625 27.3125 27.237499999999997 23.1875 86-87 22.2625 28.262500000000003 27.212500000000002 22.2625 88-89 23.3625 27.400000000000002 28.037499999999998 21.2 90-91 23.0125 27.987499999999997 26.275 22.725 92-93 22.400000000000002 27.212500000000002 27.9125 22.475 94-95 23.0125 27.125 27.5125 22.35 96-97 22.3625 28.237499999999997 27.275 22.125 98-99 22.525000000000002 27.85 27.35 22.275 100 21.95 27.224999999999998 27.725 23.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 2.5 22 3.0 23 2.0 24 2.0 25 3.0 26 8.0 27 11.0 28 9.0 29 13.5 30 22.5 31 27.5 32 35.5 33 39.0 34 52.5 35 73.0 36 83.5 37 104.5 38 128.0 39 144.0 40 176.5 41 195.0 42 195.5 43 213.5 44 246.0 45 255.0 46 250.0 47 262.5 48 233.0 49 201.0 50 168.0 51 135.5 52 130.0 53 99.5 54 66.5 55 48.0 56 39.5 57 44.5 58 46.0 59 41.5 60 33.0 61 24.0 62 22.5 63 18.5 64 10.0 65 7.0 66 6.0 67 4.5 68 7.5 69 10.0 70 8.5 71 6.5 72 6.0 73 4.5 74 4.0 75 3.5 76 2.5 77 2.0 78 1.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0625 30-31 0.08750000000000001 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08722109533468 97.7 2 0.7606490872210954 1.5 3 0.12677484787018256 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02535496957403651 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 17 0.42500000000000004 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.1375 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra Read 838929 spots for SRR3207969.sra Written 838929 spots for SRR3207969.sra Read 838920 spots for SRR3207969.sra Written 838920 spots for SRR3207969.sra SRR ids: ['SRR3207969.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dob0hxpm SRR3207969.sra spots: 16778409 blocks: [[1, 838920], [838921, 1677840], [1677841, 2516760], [2516761, 3355680], [3355681, 4194600], [4194601, 5033520], [5033521, 5872440], [5872441, 6711360], [6711361, 7550280], [7550281, 8389200], [8389201, 9228120], [9228121, 10067040], [10067041, 10905960], [10905961, 11744880], [11744881, 12583800], [12583801, 13422720], [13422721, 14261640], [14261641, 15100560], [15100561, 15939480], [15939481, 16778409]] SRR3207969 file size 4355599 SRR3207969 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207969 SRR3207969_1.fastq Input file: SRR3207969_1.fastq trimmed: SRR3207969-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:39:55 2025 >> started Tue Feb 11 21:40:04 2025 >> done (8.431s) 16778409 reads processed; of these: 3148 ( 0.02%) short reads filtered out after trimming by size control 117285 ( 0.70%) empty reads filtered out after trimming by size control 16657976 (99.28%) reads available; of these: 783284 ( 4.70%) trimmed reads available after processing 15874692 (95.30%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 499 0.00% 19 590 0.00% 20 810 0.00% 21 858 0.01% 22 1111 0.01% 23 1629 0.01% 24 1932 0.01% 25 2556 0.02% 26 2891 0.02% 27 2823 0.02% 28 2699 0.02% 29 2871 0.02% 30 2815 0.02% 31 2888 0.02% 32 3026 0.02% 33 2948 0.02% 34 3180 0.02% 35 3123 0.02% 36 3514 0.02% 37 3422 0.02% 38 3420 0.02% 39 3625 0.02% 40 3842 0.02% 41 3718 0.02% 42 4260 0.03% 43 4181 0.03% 44 4220 0.03% 45 4401 0.03% 46 4388 0.03% 47 4486 0.03% 48 4556 0.03% 49 4807 0.03% 50 4634 0.03% 51 4892 0.03% 52 5130 0.03% 53 5345 0.03% 54 5357 0.03% 55 5495 0.03% 56 5827 0.03% 57 5969 0.04% 58 6286 0.04% 59 6267 0.04% 60 6722 0.04% 61 6509 0.04% 62 7011 0.04% 63 6916 0.04% 64 6819 0.04% 65 7097 0.04% 66 7220 0.04% 67 7375 0.04% 68 8137 0.05% 69 8630 0.05% 70 8522 0.05% 71 8073 0.05% 72 8309 0.05% 73 8706 0.05% 74 8646 0.05% 75 9179 0.06% 76 6386 0.04% 77 7063 0.04% 78 7888 0.05% 79 8522 0.05% 80 9152 0.05% 81 9674 0.06% 82 10597 0.06% 83 11416 0.07% 84 11920 0.07% 85 12260 0.07% 86 13056 0.08% 87 14298 0.09% 88 15587 0.09% 89 17145 0.10% 90 18365 0.11% 91 20202 0.12% 92 23213 0.14% 93 26192 0.16% 94 30424 0.18% 95 34852 0.21% 96 40287 0.24% 97 48125 0.29% 98 54534 0.33% 99 56964 0.34% 100 15874692 95.30% 16657976 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=16.52 fanout-score-rank=3 prefix-density=0.14 prefix-fanout=16.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=165.60 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=22.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 21:40:20 Started mapping on | Feb 11 21:40:20 Finished on | Feb 11 21:40:47 Mapping speed, Million of reads per hour | 2221.06 Number of input reads | 16657976 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13767816 Uniquely mapped reads % | 82.65% Average mapped length | 98.92 Number of splices: Total | 4011330 Number of splices: Annotated (sjdb) | 3934800 Number of splices: GT/AG | 3951749 Number of splices: GC/AG | 48909 Number of splices: AT/AC | 4305 Number of splices: Non-canonical | 6367 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357325 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 2025224 % of reads mapped to too many loci | 12.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2532835 2532835 2532835 N_multimapping 357325 357325 357325 N_noFeature 701659 7155455 7215945 N_ambiguous 146502 23913 24728 UnstrandedReadsAssigned:12919655 PositiveStrandReadsAssigned:6588448 NegativeStrandReadsAssigned:6527143 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207969 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207969-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,657,976 reads, 14,973,317 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR3207969.ke.tsv 34699 SRR3207969.se.tsv 87100 total ==> SRR3207969.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 499 25.0716 Potri.005G024800.1.v4.1 1035 936 66 6.79869 Potri.004G059700.1.v4.1 961 862 5 0.559268 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 199.47 6.76247 Potri.016G087400.1.v4.1 270 171 477 268.955 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 55 3.16785 Potri.012G127500.1.v4.1 977 878 912 100.152 ==> SRR3207969.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1408 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 5 SRR3207969 completed mapping pipeline successfully