Starting /dee2/code/volunteer_pipeline.sh SRR3207970 current disk space = 3052468592640 free memory = 1579967380 SRR3207970 SRAfilesize a18cd1ddfc275663d42c00781f646c1b SRR3207970.sra SRR3207970.sra file validated SRR3207970 is single end SRR3207970 is conventional basespace SRR3207970 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207970_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1465 34.0 33.0 34.0 31.0 34.0 2 33.2395 34.0 34.0 34.0 31.0 34.0 3 33.30225 34.0 34.0 34.0 31.0 34.0 4 36.57625 37.0 37.0 37.0 35.0 37.0 5 36.48725 37.0 37.0 37.0 35.0 37.0 6 36.51475 37.0 37.0 37.0 35.0 37.0 7 36.4745 37.0 37.0 37.0 35.0 37.0 8 36.41375 37.0 37.0 37.0 35.0 37.0 9 38.3315 39.0 39.0 39.0 37.0 39.0 10-11 38.366625 39.0 39.0 39.0 37.0 39.0 12-13 38.2675 39.0 39.0 39.0 37.0 39.0 14-15 39.90825 41.0 40.0 41.0 38.0 41.0 16-17 39.888625 41.0 40.0 41.0 38.0 41.0 18-19 39.891000000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.929 41.0 40.0 41.0 38.0 41.0 22-23 39.877375 41.0 40.0 41.0 38.0 41.0 24-25 39.839875 41.0 40.0 41.0 38.0 41.0 26-27 39.667125 41.0 40.0 41.0 37.0 41.0 28-29 39.4925 41.0 40.0 41.0 36.5 41.0 30-31 39.5045 41.0 40.0 41.0 37.0 41.0 32-33 39.12875 41.0 39.5 41.0 36.0 41.0 34-35 39.26875 41.0 39.0 41.0 36.0 41.0 36-37 39.275 41.0 39.0 41.0 36.0 41.0 38-39 39.212 41.0 39.0 41.0 36.0 41.0 40-41 39.119625 41.0 39.0 41.0 35.5 41.0 42-43 39.08725 40.5 39.0 41.0 35.5 41.0 44-45 39.101625 41.0 39.0 41.0 36.0 41.0 46-47 38.85225 40.5 38.5 41.0 35.0 41.0 48-49 38.908500000000004 40.0 39.0 41.0 35.0 41.0 50-51 39.00725 41.0 39.0 41.0 35.0 41.0 52-53 39.027875 41.0 39.0 41.0 35.0 41.0 54-55 38.92825 41.0 39.0 41.0 35.0 41.0 56-57 38.8435 41.0 39.0 41.0 35.0 41.0 58-59 38.654375 40.5 38.0 41.0 35.0 41.0 60-61 38.212999999999994 40.0 37.0 41.0 34.0 41.0 62-63 38.031125 40.0 37.0 41.0 34.0 41.0 64-65 37.90525 39.5 37.0 41.0 34.0 41.0 66-67 37.579625 39.0 36.0 41.0 34.0 41.0 68-69 37.23425 39.0 36.0 41.0 34.0 41.0 70-71 36.81575 37.5 35.0 40.0 33.0 41.0 72-73 36.43675 37.0 35.0 39.0 33.5 41.0 74-75 35.796875 36.5 35.0 39.0 32.5 41.0 76-77 34.98925 36.0 34.5 37.5 31.0 39.0 78-79 34.971374999999995 36.0 35.0 37.0 32.0 39.0 80-81 34.800625 35.0 35.0 37.0 32.0 39.0 82-83 34.41 35.0 35.0 36.5 32.0 37.0 84-85 34.206375 35.0 35.0 36.0 32.0 37.0 86-87 33.98125 35.0 35.0 36.0 32.0 37.0 88-89 33.752125 35.0 35.0 35.0 31.5 36.0 90-91 33.564875 35.0 35.0 35.0 31.0 36.0 92-93 33.29325 35.0 34.0 35.0 31.0 36.0 94-95 33.134 35.0 34.0 35.0 30.5 36.0 96-97 33.017625 35.0 34.0 35.0 30.0 36.0 98-99 32.793625 35.0 34.0 35.0 30.0 35.0 100 32.555 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 5.0 16 1.0 17 4.0 18 2.0 19 6.0 20 6.0 21 5.0 22 6.0 23 6.0 24 6.0 25 10.0 26 17.0 27 18.0 28 24.0 29 39.0 30 27.0 31 41.0 32 53.0 33 66.0 34 105.0 35 156.0 36 287.0 37 737.0 38 1729.0 39 632.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.025000000000002 16.2 13.8 46.975 2 19.3 23.400000000000002 38.45 18.85 3 20.349999999999998 27.200000000000003 27.224999999999998 25.224999999999998 4 22.400000000000002 32.425 21.85 23.325000000000003 5 22.755688922230558 34.70867716929232 24.031007751937985 18.504626156539132 6 18.025 36.775000000000006 26.05 19.15 7 17.825 18.325 43.225 20.625 8 17.95 24.349999999999998 30.2 27.500000000000004 9 19.525000000000002 25.124999999999996 31.075000000000003 24.275 10-11 21.8 33.1125 24.0375 21.05 12-13 21.087500000000002 26.875 29.5 22.537499999999998 14-15 19.8625 28.462500000000002 28.475 23.200000000000003 16-17 21.712500000000002 28.599999999999998 27.775 21.912499999999998 18-19 21.087500000000002 28.787499999999998 27.750000000000004 22.375 20-21 21.85 28.1125 27.712500000000002 22.325 22-23 21.1375 28.375 28.0875 22.400000000000002 24-25 21.13292484681756 28.548205577091405 28.548205577091405 21.770663998999627 26-27 21.15 28.95 28.1625 21.7375 28-29 21.534034034034033 28.47847847847848 27.765265265265267 22.22222222222222 30-31 22.037291953447628 28.694781629333 28.206732574145914 21.061193843073458 32-33 21.837500000000002 28.549999999999997 26.987499999999997 22.625 34-35 21.2875 28.4375 27.762500000000003 22.5125 36-37 21.775 28.549999999999997 27.6625 22.0125 38-39 21.8625 27.962500000000002 28.037499999999998 22.1375 40-41 22.9375 27.900000000000002 27.9375 21.224999999999998 42-43 21.75 28.4 27.175 22.675 44-45 21.2875 27.8125 28.4375 22.4625 46-47 22.3125 27.625 29.049999999999997 21.0125 48-49 21.3 29.0875 27.237499999999997 22.375 50-51 21.2375 28.475 27.9375 22.35 52-53 21.224999999999998 28.125 28.449999999999996 22.2 54-55 21.8 28.3125 27.962500000000002 21.925 56-57 20.474999999999998 28.925 28.287499999999998 22.3125 58-59 21.65 28.7 27.55 22.1 60-61 21.975 28.4 28.287499999999998 21.337500000000002 62-63 21.875 28.075 28.475 21.575 64-65 21.175 28.262500000000003 28.275 22.287499999999998 66-67 20.7125 28.212500000000002 28.625 22.45 68-69 21.6125 28.8625 27.762500000000003 21.762500000000003 70-71 22.3625 28.1125 27.5875 21.9375 72-73 22.4625 27.825 28.249999999999996 21.462500000000002 74-75 22.2625 27.700000000000003 28.15 21.8875 76-77 21.6625 28.487499999999997 27.762500000000003 22.0875 78-79 21.9625 28.212500000000002 28.175 21.65 80-81 22.05 27.650000000000002 28.599999999999998 21.7 82-83 21.3625 28.787499999999998 28.287499999999998 21.5625 84-85 21.7875 27.575 28.712500000000002 21.925 86-87 21.875 29.125 27.275 21.725 88-89 21.425 28.3125 27.825 22.4375 90-91 21.7 27.825 28.712500000000002 21.762500000000003 92-93 22.3875 27.950000000000003 27.5125 22.15 94-95 22.175 28.249999999999996 27.950000000000003 21.625 96-97 21.2375 28.449999999999996 27.875 22.4375 98-99 22.2 28.237499999999997 27.700000000000003 21.8625 100 22.650000000000002 27.950000000000003 27.35 22.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 2.0 25 1.5 26 2.5 27 6.0 28 10.0 29 14.0 30 20.5 31 32.5 32 43.0 33 54.0 34 64.5 35 75.5 36 102.5 37 126.5 38 145.5 39 183.0 40 203.0 41 221.5 42 254.5 43 249.5 44 252.5 45 262.0 46 253.5 47 250.5 48 217.0 49 173.5 50 159.5 51 138.0 52 97.0 53 81.0 54 70.5 55 54.0 56 44.5 57 30.0 58 21.0 59 13.0 60 10.0 61 11.5 62 10.5 63 8.0 64 5.5 65 5.0 66 3.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.1 30-31 0.11249999999999999 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650672 spots for SRR3207970.sra Written 650672 spots for SRR3207970.sra Read 650675 spots for SRR3207970.sra Written 650675 spots for SRR3207970.sra SRR ids: ['SRR3207970.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nura4h2q SRR3207970.sra spots: 13013443 blocks: [[1, 650672], [650673, 1301344], [1301345, 1952016], [1952017, 2602688], [2602689, 3253360], [3253361, 3904032], [3904033, 4554704], [4554705, 5205376], [5205377, 5856048], [5856049, 6506720], [6506721, 7157392], [7157393, 7808064], [7808065, 8458736], [8458737, 9109408], [9109409, 9760080], [9760081, 10410752], [10410753, 11061424], [11061425, 11712096], [11712097, 12362768], [12362769, 13013443]] SRR3207970 file size 3375853 SRR3207970 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207970 SRR3207970_1.fastq Input file: SRR3207970_1.fastq trimmed: SRR3207970-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:10:02 2025 >> started Tue Feb 11 22:10:08 2025 >> done (6.646s) 13013443 reads processed; of these: 2069 ( 0.02%) short reads filtered out after trimming by size control 11952 ( 0.09%) empty reads filtered out after trimming by size control 12999422 (99.89%) reads available; of these: 560714 ( 4.31%) trimmed reads available after processing 12438708 (95.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 240 0.00% 19 309 0.00% 20 397 0.00% 21 478 0.00% 22 695 0.01% 23 947 0.01% 24 1229 0.01% 25 1633 0.01% 26 2208 0.02% 27 2209 0.02% 28 1910 0.01% 29 1881 0.01% 30 1772 0.01% 31 1803 0.01% 32 1975 0.02% 33 1883 0.01% 34 1953 0.02% 35 2030 0.02% 36 2186 0.02% 37 2137 0.02% 38 2424 0.02% 39 2453 0.02% 40 2426 0.02% 41 2579 0.02% 42 2657 0.02% 43 2691 0.02% 44 2776 0.02% 45 2730 0.02% 46 2978 0.02% 47 3008 0.02% 48 3068 0.02% 49 3191 0.02% 50 3050 0.02% 51 3161 0.02% 52 3361 0.03% 53 3479 0.03% 54 3664 0.03% 55 3741 0.03% 56 3881 0.03% 57 3908 0.03% 58 3949 0.03% 59 4037 0.03% 60 4136 0.03% 61 4301 0.03% 62 4470 0.03% 63 4426 0.03% 64 4600 0.04% 65 4818 0.04% 66 4990 0.04% 67 5162 0.04% 68 5333 0.04% 69 5314 0.04% 70 5419 0.04% 71 5599 0.04% 72 5933 0.05% 73 6019 0.05% 74 6436 0.05% 75 6348 0.05% 76 4699 0.04% 77 5292 0.04% 78 5755 0.04% 79 6266 0.05% 80 6590 0.05% 81 7019 0.05% 82 7570 0.06% 83 8048 0.06% 84 8520 0.07% 85 9208 0.07% 86 9745 0.07% 87 10553 0.08% 88 11110 0.09% 89 12092 0.09% 90 13436 0.10% 91 14819 0.11% 92 16995 0.13% 93 19244 0.15% 94 22111 0.17% 95 25729 0.20% 96 30753 0.24% 97 36197 0.28% 98 40198 0.31% 99 46374 0.36% 100 12438708 95.69% 12999422 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=122.03 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=12.7 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGG Started job on | Feb 11 22:10:27 Started mapping on | Feb 11 22:10:27 Finished on | Feb 11 22:10:44 Mapping speed, Million of reads per hour | 2752.82 Number of input reads | 12999422 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11955826 Uniquely mapped reads % | 91.97% Average mapped length | 98.96 Number of splices: Total | 3388932 Number of splices: Annotated (sjdb) | 3312145 Number of splices: GT/AG | 3331875 Number of splices: GC/AG | 46956 Number of splices: AT/AC | 3818 Number of splices: Non-canonical | 6283 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438519 % of reads mapped to multiple loci | 3.37% Number of reads mapped to too many loci | 122400 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605077 605077 605077 N_multimapping 438519 438519 438519 N_noFeature 623933 6226460 6279131 N_ambiguous 122846 24861 24027 UnstrandedReadsAssigned:11209047 PositiveStrandReadsAssigned:5704505 NegativeStrandReadsAssigned:5652668 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207970 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207970-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,999,422 reads, 11,657,363 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR3207970.ke.tsv 34699 SRR3207970.se.tsv 87100 total ==> SRR3207970.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 880 51.8145 Potri.005G024800.1.v4.1 1035 936 1844 222.602 Potri.004G059700.1.v4.1 961 862 2 0.26216 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 302.458 12.0166 Potri.016G087400.1.v4.1 270 171 257 169.817 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 302 20.3843 Potri.012G127500.1.v4.1 977 878 1420 182.742 ==> SRR3207970.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 248 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 191 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 66 SRR3207970 completed mapping pipeline successfully