Starting /dee2/code/volunteer_pipeline.sh SRR3207971 current disk space = 3052612603904 free memory = 1328165392 SRR3207971 SRAfilesize fdfd1dc70e850a8d5361a2aa1626950f SRR3207971.sra SRR3207971.sra file validated SRR3207971 is single end SRR3207971 is conventional basespace SRR3207971 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207971_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09325 34.0 33.0 34.0 31.0 34.0 2 33.308 34.0 34.0 34.0 31.0 34.0 3 33.339 34.0 34.0 34.0 31.0 34.0 4 36.60275 37.0 37.0 37.0 35.0 37.0 5 36.51 37.0 37.0 37.0 35.0 37.0 6 36.492 37.0 37.0 37.0 35.0 37.0 7 36.514 37.0 37.0 37.0 35.0 37.0 8 36.47575 37.0 37.0 37.0 35.0 37.0 9 38.42325 39.0 39.0 39.0 37.0 39.0 10-11 38.402 39.0 39.0 39.0 37.0 39.0 12-13 38.308 39.0 39.0 39.0 37.0 39.0 14-15 39.96625 41.0 40.0 41.0 38.0 41.0 16-17 39.958875000000006 41.0 40.0 41.0 38.0 41.0 18-19 39.979875 41.0 40.0 41.0 38.0 41.0 20-21 40.016875 41.0 40.0 41.0 38.0 41.0 22-23 39.86175 41.0 40.0 41.0 38.0 41.0 24-25 39.83525 41.0 40.0 41.0 38.0 41.0 26-27 39.6935 41.0 40.0 41.0 37.5 41.0 28-29 39.59175 41.0 40.0 41.0 37.0 41.0 30-31 39.58725 41.0 40.0 41.0 37.0 41.0 32-33 39.230000000000004 41.0 39.5 41.0 36.0 41.0 34-35 39.399125 41.0 39.5 41.0 37.0 41.0 36-37 39.354124999999996 41.0 40.0 41.0 36.5 41.0 38-39 39.321 41.0 39.5 41.0 36.5 41.0 40-41 39.23025 40.5 39.0 41.0 36.5 41.0 42-43 39.1295 40.5 39.0 41.0 36.0 41.0 44-45 39.172125 41.0 39.0 41.0 36.0 41.0 46-47 38.952875 41.0 39.0 41.0 35.5 41.0 48-49 38.969625 41.0 39.0 41.0 35.0 41.0 50-51 39.103375 41.0 39.0 41.0 35.0 41.0 52-53 39.169624999999996 41.0 39.0 41.0 36.0 41.0 54-55 38.948875 41.0 39.0 41.0 35.0 41.0 56-57 38.9025 41.0 39.0 41.0 35.0 41.0 58-59 38.717749999999995 40.5 38.0 41.0 35.0 41.0 60-61 38.367875 40.0 37.5 41.0 34.5 41.0 62-63 38.175 40.0 37.0 41.0 34.0 41.0 64-65 38.013374999999996 39.5 37.0 41.0 34.0 41.0 66-67 37.661 39.0 36.0 41.0 34.0 41.0 68-69 37.256375 39.0 35.5 41.0 34.0 41.0 70-71 36.898375 37.5 35.0 40.0 34.0 41.0 72-73 36.5115 37.0 35.0 39.0 33.5 41.0 74-75 35.926125 36.5 35.0 39.0 33.0 40.5 76-77 35.048125 36.0 34.5 37.0 31.5 39.0 78-79 35.036625 36.0 35.0 37.0 32.0 39.0 80-81 34.79975 35.0 35.0 37.0 32.0 39.0 82-83 34.480000000000004 35.0 35.0 36.0 32.0 37.0 84-85 34.305375 35.0 35.0 36.0 32.0 37.0 86-87 34.042625 35.0 35.0 36.0 32.0 37.0 88-89 33.81125 35.0 35.0 35.0 31.5 36.0 90-91 33.668125 35.0 34.5 35.0 31.5 36.0 92-93 33.434625 35.0 34.0 35.0 31.0 36.0 94-95 33.308375 35.0 34.0 35.0 31.0 36.0 96-97 33.206374999999994 35.0 34.0 35.0 31.0 35.0 98-99 33.034875 35.0 34.0 35.0 30.5 35.0 100 32.75875 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 1.0 10 1.0 11 3.0 12 2.0 13 4.0 14 0.0 15 3.0 16 2.0 17 2.0 18 3.0 19 4.0 20 4.0 21 4.0 22 2.0 23 6.0 24 6.0 25 10.0 26 11.0 27 20.0 28 24.0 29 18.0 30 37.0 31 40.0 32 61.0 33 69.0 34 97.0 35 146.0 36 264.0 37 783.0 38 1729.0 39 641.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.425 16.1 13.975000000000001 45.5 2 19.25 22.8 37.625 20.325 3 20.200000000000003 27.800000000000004 28.299999999999997 23.7 4 22.375 32.1 21.375 24.15 5 23.53088272068017 34.883720930232556 23.50587646911728 18.079519879969993 6 19.650000000000002 37.55 25.2 17.599999999999998 7 17.8 18.825 42.625 20.75 8 18.375 24.875 30.025000000000002 26.724999999999998 9 19.5 24.45 32.125 23.925 10-11 22.3 33.5125 22.8875 21.3 12-13 21.099999999999998 25.9625 30.662499999999998 22.275 14-15 20.625 28.349999999999998 28.575 22.45 16-17 21.349999999999998 27.762500000000003 28.499999999999996 22.3875 18-19 21.125 28.499999999999996 27.975 22.400000000000002 20-21 21.525 28.849999999999998 27.6875 21.9375 22-23 21.637500000000003 28.025 28.512500000000003 21.825 24-25 21.33116476917303 29.025397222569747 27.41148504941824 22.231952958838985 26-27 21.0625 28.050000000000004 28.7 22.1875 28-29 20.833333333333336 28.040540540540544 27.790290290290294 23.335835835835837 30-31 21.336503566512327 28.607183080966088 28.19421849580778 21.862094856713803 32-33 21.349999999999998 28.212500000000002 28.575 21.8625 34-35 21.4125 29.125 27.437499999999996 22.025 36-37 21.55 28.8625 27.6875 21.9 38-39 21.525 28.1 28.025 22.35 40-41 22.3625 28.512500000000003 27.075 22.05 42-43 21.462500000000002 27.200000000000003 27.987499999999997 23.35 44-45 21.95 27.375 27.725 22.95 46-47 21.3625 28.287499999999998 27.425 22.925 48-49 21.175 28.6375 28.475 21.712500000000002 50-51 21.95 28.037499999999998 27.737499999999997 22.275 52-53 22.175 28.075 28.212500000000002 21.5375 54-55 21.5625 29.4875 27.474999999999998 21.475 56-57 21.2 27.35 28.749999999999996 22.7 58-59 21.337500000000002 28.65 28.125 21.8875 60-61 20.925 28.050000000000004 28.712500000000002 22.3125 62-63 22.725 27.8375 28.237499999999997 21.2 64-65 22.0125 27.925 27.6125 22.45 66-67 21.1375 28.65 28.1375 22.075 68-69 21.975 28.299999999999997 27.325 22.400000000000002 70-71 21.775 28.8375 28.512500000000003 20.875 72-73 21.8125 28.212500000000002 28.0625 21.912499999999998 74-75 22.225 28.249999999999996 27.212500000000002 22.3125 76-77 22.2625 28.212500000000002 27.6625 21.8625 78-79 22.475 27.400000000000002 28.287499999999998 21.837500000000002 80-81 21.2625 29.4 27.6125 21.725 82-83 21.637500000000003 28.199999999999996 28.675 21.4875 84-85 22.112499999999997 27.762500000000003 28.125 22.0 86-87 22.412499999999998 27.712500000000002 27.950000000000003 21.925 88-89 22.3 27.5625 27.575 22.5625 90-91 21.625 29.225 26.987499999999997 22.162499999999998 92-93 22.0875 28.875 27.6625 21.375 94-95 22.2125 28.225 27.875 21.6875 96-97 22.2 27.5625 27.800000000000004 22.4375 98-99 21.9625 28.812500000000004 27.737499999999997 21.4875 100 22.025 27.575 28.7 21.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 2.5 23 3.5 24 3.0 25 3.5 26 9.5 27 11.0 28 12.5 29 15.0 30 16.5 31 21.5 32 36.5 33 56.0 34 68.0 35 79.5 36 96.5 37 120.5 38 144.5 39 181.5 40 204.5 41 225.5 42 253.5 43 254.0 44 232.5 45 234.5 46 246.5 47 223.5 48 222.0 49 197.5 50 162.5 51 142.0 52 109.0 53 93.0 54 71.5 55 51.0 56 35.5 57 30.0 58 28.5 59 20.5 60 18.5 61 15.0 62 7.5 63 4.0 64 4.5 65 4.0 66 4.5 67 4.0 68 1.0 69 1.5 70 4.0 71 3.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.08750000000000001 26-27 0.0 28-29 0.1 30-31 0.11249999999999999 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488305 spots for SRR3207971.sra Written 488305 spots for SRR3207971.sra Read 488317 spots for SRR3207971.sra Written 488317 spots for SRR3207971.sra SRR ids: ['SRR3207971.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1b73m93q SRR3207971.sra spots: 9766112 blocks: [[1, 488305], [488306, 976610], [976611, 1464915], [1464916, 1953220], [1953221, 2441525], [2441526, 2929830], [2929831, 3418135], [3418136, 3906440], [3906441, 4394745], [4394746, 4883050], [4883051, 5371355], [5371356, 5859660], [5859661, 6347965], [6347966, 6836270], [6836271, 7324575], [7324576, 7812880], [7812881, 8301185], [8301186, 8789490], [8789491, 9277795], [9277796, 9766112]] SRR3207971 file size 2530970 SRR3207971 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207971 SRR3207971_1.fastq Input file: SRR3207971_1.fastq trimmed: SRR3207971-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 21:42:25 2025 >> started Tue Feb 11 21:42:30 2025 >> done (5.438s) 9766112 reads processed; of these: 1350 ( 0.01%) short reads filtered out after trimming by size control 11824 ( 0.12%) empty reads filtered out after trimming by size control 9752938 (99.87%) reads available; of these: 408378 ( 4.19%) trimmed reads available after processing 9344560 (95.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 184 0.00% 19 216 0.00% 20 270 0.00% 21 322 0.00% 22 471 0.00% 23 647 0.01% 24 874 0.01% 25 1199 0.01% 26 1472 0.02% 27 1503 0.02% 28 1380 0.01% 29 1359 0.01% 30 1344 0.01% 31 1289 0.01% 32 1302 0.01% 33 1380 0.01% 34 1406 0.01% 35 1472 0.02% 36 1513 0.02% 37 1536 0.02% 38 1658 0.02% 39 1658 0.02% 40 1755 0.02% 41 1799 0.02% 42 1941 0.02% 43 1894 0.02% 44 1934 0.02% 45 1964 0.02% 46 2024 0.02% 47 2090 0.02% 48 2173 0.02% 49 2172 0.02% 50 2177 0.02% 51 2342 0.02% 52 2473 0.03% 53 2406 0.02% 54 2435 0.02% 55 2640 0.03% 56 2681 0.03% 57 2792 0.03% 58 2760 0.03% 59 2822 0.03% 60 2931 0.03% 61 2909 0.03% 62 3185 0.03% 63 3177 0.03% 64 3336 0.03% 65 3380 0.03% 66 3540 0.04% 67 3665 0.04% 68 3833 0.04% 69 3822 0.04% 70 3980 0.04% 71 4100 0.04% 72 4468 0.05% 73 4480 0.05% 74 4618 0.05% 75 4542 0.05% 76 3292 0.03% 77 3729 0.04% 78 4220 0.04% 79 4549 0.05% 80 4935 0.05% 81 5135 0.05% 82 5584 0.06% 83 5814 0.06% 84 6199 0.06% 85 6746 0.07% 86 7216 0.07% 87 7581 0.08% 88 8163 0.08% 89 8986 0.09% 90 9837 0.10% 91 10745 0.11% 92 12499 0.13% 93 14097 0.14% 94 16619 0.17% 95 19145 0.20% 96 22737 0.23% 97 26375 0.27% 98 29962 0.31% 99 34518 0.35% 100 9344560 95.81% 9752938 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=26 prefix-density=0.11 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=250.72 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=25.6 sequence=TTCTTCTTCTTC Started job on | Feb 11 21:42:52 Started mapping on | Feb 11 21:42:53 Finished on | Feb 11 21:43:09 Mapping speed, Million of reads per hour | 2194.41 Number of input reads | 9752938 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 8818282 Uniquely mapped reads % | 90.42% Average mapped length | 99.02 Number of splices: Total | 2640253 Number of splices: Annotated (sjdb) | 2580731 Number of splices: GT/AG | 2595118 Number of splices: GC/AG | 37364 Number of splices: AT/AC | 3077 Number of splices: Non-canonical | 4694 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255160 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 97772 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.96% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 679496 679496 679496 N_multimapping 255160 255160 255160 N_noFeature 481275 4591628 4662980 N_ambiguous 79742 17758 17202 UnstrandedReadsAssigned:8257265 PositiveStrandReadsAssigned:4208896 NegativeStrandReadsAssigned:4138100 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207971 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207971-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,752,938 reads, 8,524,484 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52401 SRR3207971.ke.tsv 34699 SRR3207971.se.tsv 87100 total ==> SRR3207971.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 477 39.6083 Potri.005G024800.1.v4.1 1035 936 1274 216.889 Potri.004G059700.1.v4.1 961 862 4 0.739428 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 242.484 13.5862 Potri.016G087400.1.v4.1 270 171 195 181.711 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 145.757 13.8745 Potri.012G127500.1.v4.1 977 878 1131 205.263 ==> SRR3207971.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR3207971 completed mapping pipeline successfully