Starting /dee2/code/volunteer_pipeline.sh SRR3207972 current disk space = 3052320489472 free memory = 1575841748 SRR3207972 SRAfilesize 5c109fe442db65250c7058e66f92d9b9 SRR3207972.sra SRR3207972.sra file validated SRR3207972 is single end SRR3207972 is conventional basespace SRR3207972 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207972_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1235 34.0 33.0 34.0 31.0 34.0 2 33.30425 34.0 34.0 34.0 31.0 34.0 3 33.3605 34.0 34.0 34.0 31.0 34.0 4 36.64425 37.0 37.0 37.0 35.0 37.0 5 36.5105 37.0 37.0 37.0 35.0 37.0 6 36.51075 37.0 37.0 37.0 35.0 37.0 7 36.505 37.0 37.0 37.0 35.0 37.0 8 36.5075 37.0 37.0 37.0 35.0 37.0 9 38.44125 39.0 39.0 39.0 37.0 39.0 10-11 38.42825 39.0 39.0 39.0 37.0 39.0 12-13 38.35675 39.0 39.0 39.0 37.0 39.0 14-15 40.000125 41.0 40.0 41.0 38.0 41.0 16-17 39.934250000000006 41.0 40.0 41.0 38.0 41.0 18-19 39.937125 41.0 40.0 41.0 38.0 41.0 20-21 39.9645 41.0 40.0 41.0 38.0 41.0 22-23 39.873875 41.0 40.0 41.0 38.0 41.0 24-25 39.830625 41.0 40.0 41.0 38.0 41.0 26-27 39.763 41.0 40.0 41.0 38.0 41.0 28-29 39.544124999999994 41.0 40.0 41.0 37.0 41.0 30-31 39.552625 41.0 40.0 41.0 37.0 41.0 32-33 39.272499999999994 41.0 39.5 41.0 36.0 41.0 34-35 39.346125 41.0 39.5 41.0 37.0 41.0 36-37 39.3585 41.0 40.0 41.0 36.5 41.0 38-39 39.34775 41.0 39.5 41.0 37.0 41.0 40-41 39.18075 41.0 39.5 41.0 36.0 41.0 42-43 39.19175 40.5 39.0 41.0 36.0 41.0 44-45 39.23225 41.0 39.0 41.0 36.0 41.0 46-47 38.9525 41.0 39.0 41.0 35.5 41.0 48-49 38.971000000000004 41.0 39.0 41.0 35.0 41.0 50-51 39.05625 41.0 39.0 41.0 35.0 41.0 52-53 39.086875 41.0 39.0 41.0 35.0 41.0 54-55 38.899625 41.0 39.0 41.0 35.0 41.0 56-57 38.778375 41.0 39.0 41.0 35.0 41.0 58-59 38.634249999999994 40.5 38.0 41.0 35.0 41.0 60-61 38.2395 40.0 37.0 41.0 34.0 41.0 62-63 38.046875 40.0 37.0 41.0 34.0 41.0 64-65 37.84225 39.5 36.5 41.0 34.0 41.0 66-67 37.554875 39.0 36.0 41.0 34.0 41.0 68-69 37.089 39.0 35.0 41.0 34.0 41.0 70-71 36.716875 37.5 35.0 40.0 33.5 41.0 72-73 36.326875 37.0 35.0 39.0 33.0 41.0 74-75 35.824 36.5 35.0 39.0 33.0 40.5 76-77 34.925124999999994 36.0 34.5 37.0 31.5 39.0 78-79 34.96125 36.0 35.0 37.0 32.0 39.0 80-81 34.687250000000006 35.0 35.0 37.0 32.0 39.0 82-83 34.373625 35.0 35.0 36.0 32.0 37.0 84-85 34.1445 35.0 35.0 36.0 32.0 37.0 86-87 33.8925 35.0 35.0 36.0 31.5 37.0 88-89 33.739125 35.0 35.0 35.0 32.0 36.0 90-91 33.571125 35.0 35.0 35.0 32.0 36.0 92-93 33.276875000000004 35.0 34.0 35.0 31.0 36.0 94-95 33.153999999999996 35.0 34.0 35.0 31.0 36.0 96-97 33.072500000000005 35.0 34.0 35.0 31.0 35.5 98-99 32.697874999999996 35.0 34.0 35.0 30.0 35.0 100 32.53975 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 2.0 12 5.0 13 1.0 14 3.0 15 3.0 16 3.0 17 4.0 18 7.0 19 4.0 20 5.0 21 5.0 22 6.0 23 5.0 24 9.0 25 10.0 26 12.0 27 16.0 28 21.0 29 24.0 30 31.0 31 40.0 32 44.0 33 67.0 34 89.0 35 165.0 36 293.0 37 727.0 38 1775.0 39 613.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.400000000000002 16.125 15.475 45.0 2 19.55 23.200000000000003 37.574999999999996 19.675 3 19.900000000000002 25.474999999999998 28.9 25.724999999999998 4 22.225 32.15 22.2 23.425 5 23.65 34.35 23.65 18.35 6 19.2 35.475 24.85 20.474999999999998 7 18.05 18.8 42.875 20.275000000000002 8 18.224999999999998 23.775 31.275 26.724999999999998 9 19.75 23.724999999999998 33.025 23.5 10-11 23.025000000000002 32.087500000000006 23.825 21.0625 12-13 20.8125 26.6125 29.099999999999998 23.474999999999998 14-15 20.4625 27.575 29.062500000000004 22.900000000000002 16-17 22.2125 28.125 27.275 22.3875 18-19 21.2625 28.125 27.737499999999997 22.875 20-21 20.75 28.225 29.012500000000003 22.0125 22-23 21.1875 29.125 28.287499999999998 21.4 24-25 21.701063164477798 29.193245778611633 27.029393370856784 22.076297686053785 26-27 21.6 28.925 28.6125 20.8625 28-29 21.7940698110847 27.836857250093832 28.362317027398976 22.006755911422495 30-31 22.02202202202202 28.47847847847848 27.489989989989986 22.00950950950951 32-33 21.2875 29.812499999999996 26.8625 22.037499999999998 34-35 21.25 29.037499999999998 28.050000000000004 21.6625 36-37 21.725 28.237499999999997 28.349999999999998 21.6875 38-39 21.212500000000002 28.5875 27.537499999999998 22.662499999999998 40-41 22.412499999999998 28.8625 27.85 20.875 42-43 21.425 28.3375 28.4 21.837500000000002 44-45 21.8 27.9375 28.1375 22.125 46-47 21.4 28.712500000000002 27.55 22.3375 48-49 21.95 29.3875 27.212500000000002 21.45 50-51 21.8875 28.762500000000003 27.500000000000004 21.85 52-53 21.987499999999997 27.575 27.3 23.1375 54-55 22.3125 28.449999999999996 27.5875 21.65 56-57 22.15 28.037499999999998 28.050000000000004 21.762500000000003 58-59 22.2125 28.3125 27.8625 21.6125 60-61 21.2625 28.000000000000004 28.812500000000004 21.925 62-63 21.8125 28.075 28.275 21.837500000000002 64-65 21.512500000000003 28.262500000000003 27.800000000000004 22.425 66-67 21.9625 29.125 27.3125 21.6 68-69 22.05 28.712500000000002 27.3125 21.925 70-71 21.775 28.4375 27.9125 21.875 72-73 21.337500000000002 28.3625 28.1625 22.1375 74-75 22.237499999999997 27.9125 28.037499999999998 21.8125 76-77 21.912499999999998 28.6375 28.4375 21.0125 78-79 22.875 28.7 26.575 21.85 80-81 22.112499999999997 27.900000000000002 28.125 21.8625 82-83 21.837500000000002 28.3625 27.775 22.025 84-85 21.95 28.075 27.950000000000003 22.025 86-87 22.025 28.175 27.85 21.95 88-89 21.0125 28.7375 27.575 22.675 90-91 22.225 27.437499999999996 28.175 22.162499999999998 92-93 21.3625 28.525 28.075 22.037499999999998 94-95 21.4 28.212500000000002 28.5625 21.825 96-97 22.3625 27.487499999999997 27.5875 22.5625 98-99 21.762500000000003 28.875 28.3125 21.05 100 21.725 28.175 28.625 21.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 4.5 22 3.5 23 1.0 24 5.0 25 7.0 26 5.0 27 11.5 28 18.5 29 20.5 30 24.5 31 25.0 32 34.5 33 60.5 34 70.5 35 87.0 36 104.0 37 125.0 38 155.0 39 175.0 40 205.5 41 228.0 42 235.0 43 252.0 44 263.0 45 250.5 46 246.0 47 221.5 48 184.0 49 163.0 50 147.0 51 129.5 52 103.0 53 75.5 54 57.5 55 46.0 56 38.0 57 31.5 58 26.5 59 22.0 60 22.5 61 21.5 62 12.5 63 10.5 64 10.5 65 11.0 66 8.0 67 6.5 68 6.0 69 4.0 70 3.5 71 2.0 72 1.5 73 1.0 74 1.5 75 3.5 76 2.5 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0625 26-27 0.0 28-29 0.08750000000000001 30-31 0.1 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74918485076498 99.425 2 0.2257336343115124 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.025081514923501375 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595678 spots for SRR3207972.sra Written 595678 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra Read 595672 spots for SRR3207972.sra Written 595672 spots for SRR3207972.sra SRR ids: ['SRR3207972.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_6s5qa1 SRR3207972.sra spots: 11913446 blocks: [[1, 595672], [595673, 1191344], [1191345, 1787016], [1787017, 2382688], [2382689, 2978360], [2978361, 3574032], [3574033, 4169704], [4169705, 4765376], [4765377, 5361048], [5361049, 5956720], [5956721, 6552392], [6552393, 7148064], [7148065, 7743736], [7743737, 8339408], [8339409, 8935080], [8935081, 9530752], [9530753, 10126424], [10126425, 10722096], [10722097, 11317768], [11317769, 11913446]] SRR3207972 file size 3089586 SRR3207972 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207972 SRR3207972_1.fastq Input file: SRR3207972_1.fastq trimmed: SRR3207972-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:23:40 2025 >> started Tue Feb 11 22:23:46 2025 >> done (6.155s) 11913446 reads processed; of these: 1669 ( 0.01%) short reads filtered out after trimming by size control 18289 ( 0.15%) empty reads filtered out after trimming by size control 11893488 (99.83%) reads available; of these: 512341 ( 4.31%) trimmed reads available after processing 11381147 (95.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 233 0.00% 19 312 0.00% 20 404 0.00% 21 418 0.00% 22 633 0.01% 23 828 0.01% 24 1187 0.01% 25 1535 0.01% 26 1983 0.02% 27 2001 0.02% 28 1808 0.02% 29 1856 0.02% 30 1785 0.02% 31 1742 0.01% 32 1805 0.02% 33 1888 0.02% 34 1823 0.02% 35 1965 0.02% 36 2009 0.02% 37 2010 0.02% 38 2140 0.02% 39 2168 0.02% 40 2343 0.02% 41 2449 0.02% 42 2449 0.02% 43 2432 0.02% 44 2606 0.02% 45 2611 0.02% 46 2797 0.02% 47 2714 0.02% 48 2706 0.02% 49 2934 0.02% 50 2829 0.02% 51 3008 0.03% 52 3093 0.03% 53 3157 0.03% 54 3280 0.03% 55 3470 0.03% 56 3439 0.03% 57 3477 0.03% 58 3627 0.03% 59 3689 0.03% 60 3818 0.03% 61 3853 0.03% 62 3968 0.03% 63 4013 0.03% 64 4289 0.04% 65 4284 0.04% 66 4443 0.04% 67 4694 0.04% 68 4837 0.04% 69 4975 0.04% 70 5122 0.04% 71 5262 0.04% 72 5422 0.05% 73 5601 0.05% 74 5907 0.05% 75 5943 0.05% 76 4218 0.04% 77 4692 0.04% 78 5266 0.04% 79 5517 0.05% 80 6020 0.05% 81 6415 0.05% 82 6940 0.06% 83 7261 0.06% 84 7822 0.07% 85 8378 0.07% 86 9014 0.08% 87 9667 0.08% 88 10208 0.09% 89 11424 0.10% 90 12167 0.10% 91 13358 0.11% 92 15469 0.13% 93 17374 0.15% 94 20118 0.17% 95 23735 0.20% 96 27933 0.23% 97 32830 0.28% 98 36323 0.31% 99 42118 0.35% 100 11381147 95.69% 11893488 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.91 fanout-score-rank=13 prefix-density=0.16 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCTTTGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=169.61 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.2 sequence=AAGAAGAAGAAA Started job on | Feb 11 22:24:08 Started mapping on | Feb 11 22:24:08 Finished on | Feb 11 22:24:33 Mapping speed, Million of reads per hour | 1712.66 Number of input reads | 11893488 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10375119 Uniquely mapped reads % | 87.23% Average mapped length | 98.99 Number of splices: Total | 3041615 Number of splices: Annotated (sjdb) | 2971495 Number of splices: GT/AG | 2989516 Number of splices: GC/AG | 42604 Number of splices: AT/AC | 3923 Number of splices: Non-canonical | 5572 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.06 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291808 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 234800 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.33% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1226561 1226561 1226561 N_multimapping 291808 291808 291808 N_noFeature 610526 5437499 5494862 N_ambiguous 95346 21432 20830 UnstrandedReadsAssigned:9669247 PositiveStrandReadsAssigned:4916188 NegativeStrandReadsAssigned:4859427 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207972 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207972-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,893,488 reads, 10,073,825 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR3207972.ke.tsv 34699 SRR3207972.se.tsv 87100 total ==> SRR3207972.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 685 48.4064 Potri.005G024800.1.v4.1 1035 936 1292 187.186 Potri.004G059700.1.v4.1 961 862 2 0.314637 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 282.665 13.4781 Potri.016G087400.1.v4.1 270 171 202 160.193 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 102 8.26288 Potri.012G127500.1.v4.1 977 878 1379 212.989 ==> SRR3207972.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 62 SRR3207972 completed mapping pipeline successfully