Starting /dee2/code/volunteer_pipeline.sh SRR3207973 current disk space = 3052473958400 free memory = 1485582224 SRR3207973 SRAfilesize e43364348726708946c65eb6dd445226 SRR3207973.sra SRR3207973.sra file validated SRR3207973 is single end SRR3207973 is conventional basespace SRR3207973 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207973_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2195 34.0 33.0 34.0 31.0 34.0 2 33.34725 34.0 34.0 34.0 31.0 34.0 3 33.39275 34.0 34.0 34.0 31.0 34.0 4 36.414 37.0 37.0 37.0 35.0 37.0 5 36.49375 37.0 37.0 37.0 35.0 37.0 6 36.57425 37.0 37.0 37.0 35.0 37.0 7 36.487 37.0 37.0 37.0 35.0 37.0 8 36.509 37.0 37.0 37.0 35.0 37.0 9 38.4045 39.0 39.0 39.0 37.0 39.0 10-11 38.39675 39.0 39.0 39.0 37.0 39.0 12-13 38.389624999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.084125 41.0 40.0 41.0 38.0 41.0 16-17 40.044375 41.0 40.0 41.0 38.0 41.0 18-19 40.031000000000006 41.0 40.0 41.0 38.0 41.0 20-21 40.006 41.0 40.0 41.0 38.0 41.0 22-23 39.8975 41.0 40.0 41.0 38.0 41.0 24-25 39.847375 41.0 40.0 41.0 38.0 41.0 26-27 39.8095 41.0 40.0 41.0 38.0 41.0 28-29 39.72 41.0 40.0 41.0 38.0 41.0 30-31 39.446124999999995 41.0 40.0 41.0 37.0 41.0 32-33 39.545500000000004 41.0 40.0 41.0 37.0 41.0 34-35 39.414125 41.0 40.0 41.0 37.0 41.0 36-37 39.385999999999996 41.0 39.5 41.0 37.0 41.0 38-39 39.269 41.0 39.0 41.0 36.0 41.0 40-41 39.054125 40.5 39.0 41.0 35.5 41.0 42-43 39.064 40.5 39.0 41.0 36.0 41.0 44-45 38.892875000000004 40.5 39.0 41.0 35.5 41.0 46-47 39.009125 40.5 39.0 41.0 35.0 41.0 48-49 38.943124999999995 40.5 39.0 41.0 35.0 41.0 50-51 39.107625 41.0 39.0 41.0 36.0 41.0 52-53 39.129 41.0 39.0 41.0 36.0 41.0 54-55 39.105 41.0 39.0 41.0 35.5 41.0 56-57 38.947125 41.0 39.0 41.0 35.0 41.0 58-59 38.784 41.0 38.5 41.0 35.0 41.0 60-61 38.56375 40.0 38.0 41.0 35.0 41.0 62-63 38.20075 40.0 37.0 41.0 34.5 41.0 64-65 37.907624999999996 39.5 37.0 41.0 34.0 41.0 66-67 37.525875 39.0 36.0 41.0 34.0 41.0 68-69 37.177125000000004 39.0 36.0 40.5 34.0 41.0 70-71 36.803 37.5 35.0 40.0 34.0 41.0 72-73 36.4015 37.0 35.0 39.0 33.5 41.0 74-75 35.923 36.5 35.0 39.0 33.0 40.5 76-77 34.935875 36.0 34.5 37.0 31.0 39.0 78-79 34.9875 36.0 35.0 37.0 32.0 39.0 80-81 34.76525 35.0 35.0 37.0 32.5 39.0 82-83 34.439625 35.0 35.0 36.0 32.0 37.0 84-85 34.248999999999995 35.0 35.0 36.0 32.0 37.0 86-87 34.06175 35.0 35.0 36.0 32.0 36.5 88-89 33.75375 35.0 34.5 35.0 31.5 36.0 90-91 33.641625 35.0 34.0 35.0 31.0 36.0 92-93 33.563125 35.0 34.0 35.0 31.0 36.0 94-95 33.40875 35.0 34.0 35.0 31.0 36.0 96-97 33.273250000000004 35.0 34.0 35.0 31.0 35.0 98-99 33.137249999999995 35.0 34.0 35.0 31.0 35.0 100 32.98175 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 2.0 11 1.0 12 4.0 13 6.0 14 3.0 15 3.0 16 2.0 17 5.0 18 1.0 19 2.0 20 5.0 21 4.0 22 6.0 23 7.0 24 4.0 25 10.0 26 13.0 27 13.0 28 10.0 29 23.0 30 32.0 31 39.0 32 47.0 33 60.0 34 101.0 35 149.0 36 275.0 37 750.0 38 1843.0 39 574.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.025 15.625 12.525 47.825 2 18.675 23.75 39.525 18.05 3 20.674999999999997 27.500000000000004 27.875 23.95 4 24.25 32.85 20.575 22.325 5 24.8062015503876 35.0587646911728 21.75543885971493 18.37959489872468 6 17.625 36.75 25.525 20.1 7 16.650000000000002 19.575 42.925000000000004 20.849999999999998 8 18.45 23.65 30.875000000000004 27.025 9 20.125 23.025000000000002 31.674999999999997 25.174999999999997 10-11 22.4875 33.125 22.912499999999998 21.475 12-13 20.474999999999998 27.2625 28.175 24.087500000000002 14-15 20.525 28.999999999999996 27.825 22.650000000000002 16-17 22.3 27.375 28.1625 22.162499999999998 18-19 20.825 28.425 27.737499999999997 23.0125 20-21 21.95 27.962500000000002 28.000000000000004 22.0875 22-23 22.15 28.349999999999998 27.224999999999998 22.275 24-25 21.891418563922944 28.73405053790343 27.745809357017766 21.62872154115587 26-27 21.125 28.825 27.125 22.925 28-29 21.415153412648717 28.929242329367565 27.86474639949906 21.790857858484657 30-31 21.56371382032327 28.229545169778227 26.838742012279166 23.367998997619345 32-33 21.6875 28.537499999999998 28.050000000000004 21.725 34-35 21.675 29.6375 27.075 21.6125 36-37 21.4875 28.725 27.3125 22.475 38-39 22.125 28.0875 27.9375 21.85 40-41 22.475 28.762500000000003 27.1375 21.625 42-43 22.025 27.762500000000003 28.275 21.9375 44-45 22.075 27.975 27.537499999999998 22.412499999999998 46-47 22.15 28.125 27.950000000000003 21.775 48-49 21.45 28.749999999999996 27.962500000000002 21.837500000000002 50-51 21.8625 28.375 27.5625 22.2 52-53 22.375 28.449999999999996 27.800000000000004 21.375 54-55 21.762500000000003 28.012500000000003 27.787499999999998 22.4375 56-57 22.35 28.037499999999998 28.15 21.462500000000002 58-59 22.0875 27.975 28.025 21.912499999999998 60-61 21.6125 27.6125 28.15 22.625 62-63 22.400000000000002 28.175 27.3375 22.0875 64-65 22.025 28.025 27.775 22.175 66-67 21.875 28.275 28.3625 21.4875 68-69 21.475 27.6 28.249999999999996 22.675 70-71 21.762500000000003 28.9875 27.762500000000003 21.4875 72-73 21.9375 28.875 27.237499999999997 21.95 74-75 21.4125 29.125 27.900000000000002 21.5625 76-77 22.375 29.1125 27.025 21.4875 78-79 21.5 28.325 28.4 21.775 80-81 21.4375 28.249999999999996 28.375 21.9375 82-83 21.4875 28.1375 28.812500000000004 21.5625 84-85 21.65 28.4125 28.15 21.7875 86-87 22.1 28.712500000000002 28.15 21.0375 88-89 21.6 29.1125 27.3 21.987499999999997 90-91 21.8 28.349999999999998 27.9125 21.9375 92-93 22.125 29.4875 27.0875 21.3 94-95 22.475 29.2875 26.575 21.6625 96-97 22.75 28.1125 27.1 22.037499999999998 98-99 21.55 28.175 28.425 21.85 100 22.075 28.4 27.6 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 2.0 23 2.5 24 4.0 25 5.0 26 5.0 27 6.5 28 9.0 29 14.5 30 20.0 31 23.5 32 32.0 33 44.0 34 58.0 35 74.0 36 92.0 37 109.5 38 138.0 39 162.0 40 187.0 41 227.5 42 245.0 43 267.5 44 263.0 45 270.5 46 275.5 47 245.5 48 236.0 49 207.0 50 164.0 51 131.0 52 108.0 53 88.5 54 72.5 55 51.5 56 37.0 57 30.5 58 21.5 59 12.0 60 11.5 61 9.0 62 6.5 63 8.5 64 5.0 65 4.0 66 3.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.075 26-27 0.0 28-29 0.1875 30-31 0.2375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736118 spots for SRR3207973.sra Written 736118 spots for SRR3207973.sra Read 736120 spots for SRR3207973.sra Written 736120 spots for SRR3207973.sra SRR ids: ['SRR3207973.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9rjy5qvk SRR3207973.sra spots: 14722362 blocks: [[1, 736118], [736119, 1472236], [1472237, 2208354], [2208355, 2944472], [2944473, 3680590], [3680591, 4416708], [4416709, 5152826], [5152827, 5888944], [5888945, 6625062], [6625063, 7361180], [7361181, 8097298], [8097299, 8833416], [8833417, 9569534], [9569535, 10305652], [10305653, 11041770], [11041771, 11777888], [11777889, 12514006], [12514007, 13250124], [13250125, 13986242], [13986243, 14722362]] SRR3207973 file size 3820587 SRR3207973 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207973 SRR3207973_1.fastq Input file: SRR3207973_1.fastq trimmed: SRR3207973-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:08:31 2025 >> started Tue Feb 11 22:08:42 2025 >> done (10.519s) 14722362 reads processed; of these: 2141 ( 0.01%) short reads filtered out after trimming by size control 11019 ( 0.07%) empty reads filtered out after trimming by size control 14709202 (99.91%) reads available; of these: 646024 ( 4.39%) trimmed reads available after processing 14063178 (95.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 326 0.00% 19 361 0.00% 20 484 0.00% 21 587 0.00% 22 734 0.00% 23 1019 0.01% 24 1505 0.01% 25 1858 0.01% 26 2666 0.02% 27 2314 0.02% 28 2120 0.01% 29 2005 0.01% 30 1919 0.01% 31 2075 0.01% 32 2192 0.01% 33 2214 0.02% 34 2316 0.02% 35 2353 0.02% 36 2492 0.02% 37 2452 0.02% 38 2617 0.02% 39 2730 0.02% 40 2685 0.02% 41 2816 0.02% 42 2978 0.02% 43 3136 0.02% 44 3238 0.02% 45 3330 0.02% 46 3401 0.02% 47 3606 0.02% 48 3516 0.02% 49 3760 0.03% 50 3723 0.03% 51 3900 0.03% 52 4155 0.03% 53 4520 0.03% 54 4925 0.03% 55 4144 0.03% 56 4354 0.03% 57 4424 0.03% 58 4545 0.03% 59 4710 0.03% 60 4649 0.03% 61 5045 0.03% 62 4990 0.03% 63 5034 0.03% 64 5016 0.03% 65 5549 0.04% 66 5572 0.04% 67 5593 0.04% 68 6132 0.04% 69 6167 0.04% 70 6345 0.04% 71 6608 0.04% 72 6736 0.05% 73 7180 0.05% 74 7420 0.05% 75 7528 0.05% 76 5248 0.04% 77 5872 0.04% 78 6673 0.05% 79 7358 0.05% 80 7811 0.05% 81 8414 0.06% 82 9064 0.06% 83 9417 0.06% 84 9992 0.07% 85 10768 0.07% 86 10941 0.07% 87 11916 0.08% 88 13192 0.09% 89 14131 0.10% 90 15657 0.11% 91 17212 0.12% 92 19416 0.13% 93 22232 0.15% 94 25851 0.18% 95 30041 0.20% 96 35550 0.24% 97 42151 0.29% 98 47461 0.32% 99 48887 0.33% 100 14063178 95.61% 14709202 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.81 fanout-score-rank=17 prefix-density=0.03 prefix-fanout=4.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=208.15 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=25.1 sequence=AAGAAGAAGAAA Started job on | Feb 11 22:09:00 Started mapping on | Feb 11 22:09:00 Finished on | Feb 11 22:09:18 Mapping speed, Million of reads per hour | 2941.84 Number of input reads | 14709202 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13997306 Uniquely mapped reads % | 95.16% Average mapped length | 98.93 Number of splices: Total | 4065058 Number of splices: Annotated (sjdb) | 3994210 Number of splices: GT/AG | 4005522 Number of splices: GC/AG | 49016 Number of splices: AT/AC | 4352 Number of splices: Non-canonical | 6168 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322871 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 39867 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 389025 389025 389025 N_multimapping 322871 322871 322871 N_noFeature 551672 7197517 7249870 N_ambiguous 147474 22785 23255 UnstrandedReadsAssigned:13298160 PositiveStrandReadsAssigned:6777004 NegativeStrandReadsAssigned:6724181 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207973 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207973-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,709,202 reads, 13,610,373 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR3207973.ke.tsv 34699 SRR3207973.se.tsv 87100 total ==> SRR3207973.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 484 27.1551 Potri.005G024800.1.v4.1 1035 936 85 9.77743 Potri.004G059700.1.v4.1 961 862 39 4.87123 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 187.218 7.08762 Potri.016G087400.1.v4.1 270 171 547 344.408 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 24 1.54361 Potri.012G127500.1.v4.1 977 878 1756 215.333 ==> SRR3207973.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1133 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207973 completed mapping pipeline successfully