Starting /dee2/code/volunteer_pipeline.sh SRR3207974 current disk space = 3052366708736 free memory = 1510731908 SRR3207974 SRAfilesize f164a41eab4ea44d421ace0e009f6c20 SRR3207974.sra SRR3207974.sra file validated SRR3207974 is single end SRR3207974 is conventional basespace SRR3207974 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207974_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.185 34.0 33.0 34.0 31.0 34.0 2 33.3185 34.0 34.0 34.0 31.0 34.0 3 33.36875 34.0 34.0 34.0 31.0 34.0 4 36.4185 37.0 37.0 37.0 35.0 37.0 5 36.507 37.0 37.0 37.0 35.0 37.0 6 36.5 37.0 37.0 37.0 35.0 37.0 7 36.40625 37.0 37.0 37.0 35.0 37.0 8 36.5035 37.0 37.0 37.0 35.0 37.0 9 38.39625 39.0 39.0 39.0 37.0 39.0 10-11 38.387625 39.0 39.0 39.0 37.0 39.0 12-13 38.364 39.0 39.0 39.0 37.0 39.0 14-15 39.976124999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.999750000000006 41.0 40.0 41.0 38.0 41.0 18-19 39.974375 41.0 40.0 41.0 38.0 41.0 20-21 39.887375000000006 41.0 40.0 41.0 38.0 41.0 22-23 39.842625 41.0 40.0 41.0 38.0 41.0 24-25 39.834125 41.0 40.0 41.0 38.0 41.0 26-27 39.821625 41.0 40.0 41.0 38.0 41.0 28-29 39.71175 41.0 40.0 41.0 37.5 41.0 30-31 39.3985 41.0 40.0 41.0 37.0 41.0 32-33 39.540625 41.0 40.0 41.0 37.0 41.0 34-35 39.450874999999996 41.0 40.0 41.0 37.0 41.0 36-37 39.382999999999996 41.0 40.0 41.0 37.0 41.0 38-39 39.312 41.0 40.0 41.0 37.0 41.0 40-41 39.142375 41.0 39.5 41.0 36.0 41.0 42-43 39.075625 40.5 39.0 41.0 36.0 41.0 44-45 38.981624999999994 40.5 39.0 41.0 35.5 41.0 46-47 39.08525 41.0 39.0 41.0 36.0 41.0 48-49 38.995875 40.5 39.0 41.0 36.0 41.0 50-51 39.1305 41.0 39.0 41.0 36.0 41.0 52-53 39.153999999999996 41.0 39.0 41.0 36.0 41.0 54-55 39.163875 41.0 39.0 41.0 36.0 41.0 56-57 38.941 41.0 39.0 41.0 35.0 41.0 58-59 38.734375 41.0 39.0 41.0 35.0 41.0 60-61 38.5155 40.0 38.0 41.0 35.0 41.0 62-63 38.2335 40.0 37.0 41.0 34.5 41.0 64-65 37.955875 39.5 37.0 41.0 34.0 41.0 66-67 37.613125 39.0 36.0 41.0 34.0 41.0 68-69 37.182375 39.0 36.0 41.0 33.5 41.0 70-71 36.787875 37.5 35.0 40.0 33.5 41.0 72-73 36.326625 37.0 35.0 39.0 33.0 41.0 74-75 35.89725 37.0 35.0 39.0 33.0 40.5 76-77 34.943375 36.0 34.5 37.0 31.5 39.0 78-79 35.0 36.0 35.0 37.0 32.0 39.0 80-81 34.72525 35.0 35.0 37.0 32.5 39.0 82-83 34.416625 35.0 35.0 36.0 32.0 37.0 84-85 34.144625 35.0 35.0 36.0 32.0 37.0 86-87 33.918 35.0 35.0 36.0 32.0 37.0 88-89 33.684749999999994 35.0 34.5 35.0 31.5 36.0 90-91 33.468125 35.0 34.0 35.0 31.0 36.0 92-93 33.394000000000005 35.0 34.0 35.0 31.0 36.0 94-95 33.291624999999996 35.0 34.0 35.0 31.0 36.0 96-97 33.125625 35.0 34.0 35.0 31.0 35.5 98-99 33.017875000000004 35.0 34.0 35.0 31.0 35.0 100 32.8655 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 0.0 10 0.0 11 3.0 12 4.0 13 1.0 14 6.0 15 4.0 16 5.0 17 4.0 18 2.0 19 5.0 20 2.0 21 5.0 22 5.0 23 4.0 24 16.0 25 8.0 26 17.0 27 17.0 28 19.0 29 26.0 30 26.0 31 37.0 32 43.0 33 64.0 34 96.0 35 131.0 36 260.0 37 720.0 38 1893.0 39 574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.25 16.5 13.750000000000002 47.5 2 20.1 22.875 37.875 19.15 3 19.8 26.75 27.625 25.825 4 24.325 32.925 20.125 22.625 5 24.681170292573142 35.50887721930482 21.8304576144036 17.97949487371843 6 17.549999999999997 36.7 26.3 19.45 7 17.224999999999998 18.725 43.375 20.674999999999997 8 17.875 23.599999999999998 31.15 27.375 9 18.525 22.925 32.75 25.8 10-11 22.112499999999997 33.4625 23.4375 20.9875 12-13 19.975 27.237499999999997 29.599999999999998 23.1875 14-15 20.5 27.8375 29.3375 22.325 16-17 22.3875 27.8875 27.212500000000002 22.5125 18-19 21.2875 27.3625 27.712500000000002 23.6375 20-21 20.974999999999998 29.2875 27.400000000000002 22.3375 22-23 20.8625 29.9875 26.450000000000003 22.7 24-25 20.930814462654823 29.1254847991993 27.048667584136123 22.89503315400976 26-27 21.15 28.725 27.6375 22.4875 28-29 22.067843284516208 28.451620978845916 27.42520966328702 22.055326073350855 30-31 21.122525682786268 28.038085692808817 28.401403157103484 22.437985467301427 32-33 22.025 28.237499999999997 27.500000000000004 22.237499999999997 34-35 21.4875 28.825 27.6 22.0875 36-37 20.8 28.799999999999997 28.050000000000004 22.35 38-39 20.925 28.525 28.1375 22.412499999999998 40-41 22.037499999999998 27.8625 27.825 22.275 42-43 21.1375 28.299999999999997 27.650000000000002 22.912499999999998 44-45 21.65 27.825 28.075 22.45 46-47 22.037499999999998 27.6375 27.875 22.45 48-49 21.5625 28.475 27.6125 22.35 50-51 20.9125 28.575 28.462500000000002 22.05 52-53 21.125 29.775000000000002 27.987499999999997 21.1125 54-55 21.175 28.1125 28.3375 22.375 56-57 20.9125 28.599999999999998 28.075 22.412499999999998 58-59 21.9625 29.1375 28.15 20.75 60-61 21.85 27.5125 28.0625 22.575 62-63 21.2 28.875 28.375 21.55 64-65 21.8875 27.187499999999996 29.1875 21.7375 66-67 20.6625 28.512500000000003 28.6125 22.2125 68-69 21.4375 28.725 28.1625 21.675 70-71 21.837500000000002 29.062500000000004 27.437499999999996 21.6625 72-73 21.8875 28.175 27.375 22.5625 74-75 21.6 29.425 27.212500000000002 21.762500000000003 76-77 22.325 28.825 27.3125 21.5375 78-79 21.575 28.262500000000003 28.462500000000002 21.7 80-81 21.837500000000002 28.4125 28.9125 20.837500000000002 82-83 22.3 28.1 27.9375 21.6625 84-85 21.6125 28.349999999999998 27.6625 22.375 86-87 21.6875 28.625 28.15 21.5375 88-89 21.8 27.6125 28.125 22.4625 90-91 21.375 28.549999999999997 28.349999999999998 21.725 92-93 22.112499999999997 28.037499999999998 28.512500000000003 21.337500000000002 94-95 21.9625 28.549999999999997 28.0875 21.4 96-97 20.7875 29.212500000000002 27.775 22.225 98-99 22.0875 28.7375 27.6875 21.4875 100 22.075 27.85 27.150000000000002 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.5 24 4.0 25 4.0 26 5.0 27 8.5 28 9.5 29 14.0 30 20.5 31 23.5 32 37.5 33 55.0 34 65.0 35 72.0 36 83.5 37 111.5 38 148.5 39 182.5 40 196.0 41 220.5 42 242.5 43 266.0 44 284.5 45 280.5 46 270.5 47 242.0 48 225.5 49 202.0 50 164.5 51 136.5 52 101.0 53 76.5 54 61.0 55 40.5 56 31.5 57 22.0 58 16.5 59 14.5 60 10.0 61 9.0 62 7.0 63 5.5 64 6.0 65 4.5 66 3.0 67 1.5 68 2.0 69 3.0 70 1.0 71 0.5 72 1.0 73 1.5 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.08750000000000001 26-27 0.0 28-29 0.13749999999999998 30-31 0.22499999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74893296510167 99.325 2 0.22596033140848606 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025106703489831784 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611294 spots for SRR3207974.sra Written 611294 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra Read 611293 spots for SRR3207974.sra Written 611293 spots for SRR3207974.sra SRR ids: ['SRR3207974.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_owkc64e4 SRR3207974.sra spots: 12225861 blocks: [[1, 611293], [611294, 1222586], [1222587, 1833879], [1833880, 2445172], [2445173, 3056465], [3056466, 3667758], [3667759, 4279051], [4279052, 4890344], [4890345, 5501637], [5501638, 6112930], [6112931, 6724223], [6724224, 7335516], [7335517, 7946809], [7946810, 8558102], [8558103, 9169395], [9169396, 9780688], [9780689, 10391981], [10391982, 11003274], [11003275, 11614567], [11614568, 12225861]] SRR3207974 file size 3170876 SRR3207974 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207974 SRR3207974_1.fastq Input file: SRR3207974_1.fastq trimmed: SRR3207974-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:17:35 2025 >> started Tue Feb 11 22:17:42 2025 >> done (6.985s) 12225861 reads processed; of these: 2251 ( 0.02%) short reads filtered out after trimming by size control 40846 ( 0.33%) empty reads filtered out after trimming by size control 12182764 (99.65%) reads available; of these: 530966 ( 4.36%) trimmed reads available after processing 11651798 (95.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 301 0.00% 19 337 0.00% 20 471 0.00% 21 455 0.00% 22 612 0.01% 23 882 0.01% 24 1172 0.01% 25 1532 0.01% 26 1991 0.02% 27 1753 0.01% 28 1669 0.01% 29 1662 0.01% 30 1637 0.01% 31 1684 0.01% 32 1869 0.02% 33 1900 0.02% 34 1944 0.02% 35 2062 0.02% 36 2092 0.02% 37 2041 0.02% 38 2277 0.02% 39 2172 0.02% 40 2237 0.02% 41 2391 0.02% 42 2445 0.02% 43 2571 0.02% 44 2660 0.02% 45 2642 0.02% 46 2897 0.02% 47 2812 0.02% 48 2931 0.02% 49 3020 0.02% 50 3063 0.03% 51 3189 0.03% 52 3370 0.03% 53 3635 0.03% 54 4052 0.03% 55 3352 0.03% 56 3522 0.03% 57 3631 0.03% 58 3819 0.03% 59 3836 0.03% 60 3827 0.03% 61 4074 0.03% 62 4084 0.03% 63 4251 0.03% 64 4446 0.04% 65 4753 0.04% 66 4662 0.04% 67 4579 0.04% 68 5023 0.04% 69 4998 0.04% 70 5298 0.04% 71 5798 0.05% 72 5892 0.05% 73 5880 0.05% 74 6059 0.05% 75 6057 0.05% 76 4420 0.04% 77 4785 0.04% 78 5532 0.05% 79 5925 0.05% 80 6650 0.05% 81 6822 0.06% 82 7181 0.06% 83 7696 0.06% 84 7963 0.07% 85 8727 0.07% 86 9189 0.08% 87 9722 0.08% 88 10879 0.09% 89 11800 0.10% 90 12596 0.10% 91 14140 0.12% 92 15935 0.13% 93 17939 0.15% 94 21116 0.17% 95 25009 0.21% 96 29190 0.24% 97 34562 0.28% 98 39063 0.32% 99 39854 0.33% 100 11651798 95.64% 12182764 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=7.65 fanout-score-rank=15 prefix-density=0.05 prefix-fanout=7.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=293.61 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.1 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGACTGACAAAGGCTCAGGTACACCAATAGCATAGGA Started job on | Feb 11 22:18:04 Started mapping on | Feb 11 22:18:05 Finished on | Feb 11 22:18:21 Mapping speed, Million of reads per hour | 2741.12 Number of input reads | 12182764 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11559801 Uniquely mapped reads % | 94.89% Average mapped length | 98.94 Number of splices: Total | 3287904 Number of splices: Annotated (sjdb) | 3224166 Number of splices: GT/AG | 3239040 Number of splices: GC/AG | 39946 Number of splices: AT/AC | 3529 Number of splices: Non-canonical | 5389 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265459 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 38405 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 357504 357504 357504 N_multimapping 265459 265459 265459 N_noFeature 527972 5977474 6021340 N_ambiguous 128833 19891 20107 UnstrandedReadsAssigned:10902996 PositiveStrandReadsAssigned:5562436 NegativeStrandReadsAssigned:5518354 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207974 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207974-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,182,764 reads, 11,164,171 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR3207974.ke.tsv 34699 SRR3207974.se.tsv 87100 total ==> SRR3207974.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 493 34.3952 Potri.005G024800.1.v4.1 1035 936 117 16.7354 Potri.004G059700.1.v4.1 961 862 32 4.97014 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 188.436 8.87077 Potri.016G087400.1.v4.1 270 171 431 337.448 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19 1.51958 Potri.012G127500.1.v4.1 977 878 851 129.766 ==> SRR3207974.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1304 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207974 completed mapping pipeline successfully