Starting /dee2/code/volunteer_pipeline.sh SRR3207975 current disk space = 3052365819904 free memory = 1519898936 SRR3207975 SRAfilesize 27c6d7ac0cf1c7c08cd7d83038ed60b9 SRR3207975.sra SRR3207975.sra file validated SRR3207975 is single end SRR3207975 is conventional basespace SRR3207975 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207975_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15875 34.0 33.0 34.0 31.0 34.0 2 33.28325 34.0 34.0 34.0 31.0 34.0 3 33.362 34.0 34.0 34.0 31.0 34.0 4 36.3795 37.0 37.0 37.0 35.0 37.0 5 36.43925 37.0 37.0 37.0 35.0 37.0 6 36.52675 37.0 37.0 37.0 35.0 37.0 7 36.463 37.0 37.0 37.0 35.0 37.0 8 36.512 37.0 37.0 37.0 35.0 37.0 9 38.37875 39.0 39.0 39.0 37.0 39.0 10-11 38.37925 39.0 39.0 39.0 37.0 39.0 12-13 38.3625 39.0 39.0 39.0 37.0 39.0 14-15 40.025375 41.0 40.0 41.0 38.0 41.0 16-17 40.025625000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.955 41.0 40.0 41.0 38.0 41.0 20-21 39.955124999999995 41.0 40.0 41.0 38.0 41.0 22-23 39.863249999999994 41.0 40.0 41.0 38.0 41.0 24-25 39.78775 41.0 40.0 41.0 38.0 41.0 26-27 39.787375 41.0 40.0 41.0 38.0 41.0 28-29 39.688375 41.0 40.0 41.0 38.0 41.0 30-31 39.448875 41.0 40.0 41.0 37.0 41.0 32-33 39.517375 41.0 40.0 41.0 37.0 41.0 34-35 39.4345 41.0 40.0 41.0 37.0 41.0 36-37 39.362875 41.0 40.0 41.0 37.0 41.0 38-39 39.3145 41.0 39.0 41.0 36.0 41.0 40-41 39.076 41.0 39.0 41.0 35.5 41.0 42-43 38.99725 40.5 39.0 41.0 35.5 41.0 44-45 38.956125 40.5 39.0 41.0 35.5 41.0 46-47 39.005125 40.0 39.0 41.0 35.5 41.0 48-49 38.972625 40.0 39.0 41.0 35.0 41.0 50-51 39.099000000000004 41.0 39.0 41.0 36.0 41.0 52-53 39.1495 41.0 39.0 41.0 36.0 41.0 54-55 39.136750000000006 41.0 39.0 41.0 35.5 41.0 56-57 38.931625 41.0 39.0 41.0 35.0 41.0 58-59 38.7325 41.0 38.0 41.0 35.0 41.0 60-61 38.468625 40.0 38.0 41.0 35.0 41.0 62-63 38.204 40.0 37.0 41.0 34.0 41.0 64-65 37.86425 39.5 37.0 41.0 34.0 41.0 66-67 37.60825 39.0 36.0 41.0 34.0 41.0 68-69 37.178250000000006 39.0 35.5 41.0 33.5 41.0 70-71 36.8045 37.5 35.0 40.0 33.0 41.0 72-73 36.43875 37.0 35.0 39.0 33.0 41.0 74-75 35.932625 36.5 35.0 39.0 33.0 41.0 76-77 34.930875 36.0 34.5 37.5 31.0 39.0 78-79 35.08 36.0 35.0 37.0 32.0 39.0 80-81 34.786249999999995 35.0 35.0 37.0 32.0 39.0 82-83 34.48175 35.0 35.0 36.5 32.0 37.0 84-85 34.183375 35.0 35.0 36.0 32.0 37.0 86-87 33.948875 35.0 35.0 36.0 32.0 37.0 88-89 33.641375 35.0 34.0 35.0 31.0 36.0 90-91 33.459 35.0 34.0 35.0 31.0 36.0 92-93 33.361000000000004 35.0 34.0 35.0 31.0 36.0 94-95 33.214375000000004 35.0 34.0 35.0 31.0 36.0 96-97 33.066375 35.0 34.0 35.0 31.0 35.0 98-99 32.952749999999995 35.0 34.0 35.0 31.0 35.0 100 32.77625 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 0.0 15 2.0 16 6.0 17 0.0 18 1.0 19 7.0 20 5.0 21 5.0 22 8.0 23 11.0 24 6.0 25 11.0 26 14.0 27 17.0 28 26.0 29 22.0 30 22.0 31 43.0 32 42.0 33 76.0 34 117.0 35 146.0 36 253.0 37 764.0 38 1770.0 39 614.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.924999999999997 16.0 15.125 42.95 2 20.3 24.325 36.8 18.575 3 19.775000000000002 27.075 29.15 24.0 4 22.525000000000002 33.275 21.05 23.150000000000002 5 23.080770192548137 36.60915228807202 22.53063265816454 17.779444861215303 6 18.3 37.475 24.575 19.650000000000002 7 16.375 19.3 42.699999999999996 21.625 8 18.775 24.474999999999998 30.425 26.325 9 19.575 23.849999999999998 31.924999999999997 24.65 10-11 22.5625 33.2375 22.4625 21.7375 12-13 20.424999999999997 26.525 29.65 23.400000000000002 14-15 20.9125 28.3625 28.5625 22.162499999999998 16-17 21.775 28.449999999999996 27.675 22.1 18-19 21.0125 29.062500000000004 28.0625 21.8625 20-21 21.025 28.6875 27.775 22.5125 22-23 21.325 29.575000000000003 28.012500000000003 21.087500000000002 24-25 21.366879459256477 28.576793090499436 27.537864563775187 22.518462886468896 26-27 21.3125 29.1875 26.737499999999997 22.7625 28-29 21.27552938228292 28.73073549680491 27.6657060518732 22.32802906903897 30-31 20.538847117794486 28.947368421052634 27.919799498746865 22.593984962406015 32-33 21.475 29.575000000000003 27.0125 21.9375 34-35 21.837500000000002 29.299999999999997 26.25 22.6125 36-37 21.1125 29.45 27.037499999999998 22.400000000000002 38-39 21.2375 28.000000000000004 27.6375 23.125 40-41 21.9 29.175 26.9625 21.9625 42-43 21.337500000000002 28.799999999999997 27.450000000000003 22.412499999999998 44-45 21.55 28.749999999999996 27.9125 21.7875 46-47 21.85 27.800000000000004 28.425 21.925 48-49 21.837500000000002 28.7 28.0625 21.4 50-51 21.4125 27.737499999999997 27.762500000000003 23.0875 52-53 21.375 28.287499999999998 28.075 22.2625 54-55 20.962500000000002 28.1125 28.3875 22.537499999999998 56-57 21.8875 27.625 28.225 22.2625 58-59 21.425 28.5625 27.85 22.162499999999998 60-61 20.8 29.262500000000003 27.6375 22.3 62-63 21.6 28.1875 27.800000000000004 22.412499999999998 64-65 21.575 28.3875 28.012500000000003 22.025 66-67 21.512500000000003 29.125 26.9625 22.400000000000002 68-69 21.6125 28.549999999999997 27.375 22.4625 70-71 21.462500000000002 28.875 27.825 21.837500000000002 72-73 21.8625 28.4125 27.9125 21.8125 74-75 21.1875 28.375 28.8375 21.6 76-77 21.625 28.95 27.037499999999998 22.3875 78-79 21.712500000000002 28.775000000000002 28.825 20.6875 80-81 22.55 28.9875 26.55 21.912499999999998 82-83 21.8625 28.537499999999998 27.275 22.325 84-85 21.2875 28.962500000000002 27.8875 21.8625 86-87 22.0875 28.0625 27.3875 22.4625 88-89 21.7875 28.512500000000003 28.375 21.325 90-91 23.1125 27.9375 27.525 21.425 92-93 21.4375 28.95 27.750000000000004 21.8625 94-95 21.987499999999997 29.3375 27.3 21.375 96-97 22.5125 28.349999999999998 27.450000000000003 21.6875 98-99 21.8625 29.612500000000004 27.187499999999996 21.337500000000002 100 22.0 28.749999999999996 27.700000000000003 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 0.5 22 2.0 23 3.0 24 1.5 25 1.0 26 5.0 27 6.5 28 7.5 29 13.5 30 18.5 31 27.0 32 39.0 33 46.5 34 63.0 35 72.0 36 92.0 37 122.0 38 152.0 39 167.5 40 192.0 41 245.5 42 259.5 43 262.5 44 276.0 45 286.0 46 274.0 47 242.5 48 215.5 49 184.5 50 150.0 51 129.0 52 101.0 53 73.0 54 60.5 55 47.5 56 36.0 57 26.5 58 19.0 59 12.5 60 9.5 61 8.0 62 9.0 63 10.5 64 7.5 65 4.0 66 3.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.13749999999999998 26-27 0.0 28-29 0.2375 30-31 0.25 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8745609633718 99.52499999999999 2 0.10035122930255895 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025087807325639738 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966552 spots for SRR3207975.sra Written 966552 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra Read 966535 spots for SRR3207975.sra Written 966535 spots for SRR3207975.sra SRR ids: ['SRR3207975.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s_v3hy_1 SRR3207975.sra spots: 19330717 blocks: [[1, 966535], [966536, 1933070], [1933071, 2899605], [2899606, 3866140], [3866141, 4832675], [4832676, 5799210], [5799211, 6765745], [6765746, 7732280], [7732281, 8698815], [8698816, 9665350], [9665351, 10631885], [10631886, 11598420], [11598421, 12564955], [12564956, 13531490], [13531491, 14498025], [14498026, 15464560], [15464561, 16431095], [16431096, 17397630], [17397631, 18364165], [18364166, 19330717]] SRR3207975 file size 5019876 SRR3207975 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207975 SRR3207975_1.fastq Input file: SRR3207975_1.fastq trimmed: SRR3207975-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:17:53 2025 >> started Tue Feb 11 22:18:06 2025 >> done (13.587s) 19330717 reads processed; of these: 2976 ( 0.02%) short reads filtered out after trimming by size control 40513 ( 0.21%) empty reads filtered out after trimming by size control 19287228 (99.78%) reads available; of these: 835034 ( 4.33%) trimmed reads available after processing 18452194 (95.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 404 0.00% 19 484 0.00% 20 584 0.00% 21 764 0.00% 22 968 0.01% 23 1356 0.01% 24 1873 0.01% 25 2389 0.01% 26 2955 0.02% 27 2799 0.01% 28 2594 0.01% 29 2532 0.01% 30 2632 0.01% 31 2544 0.01% 32 2888 0.01% 33 2883 0.01% 34 3005 0.02% 35 3121 0.02% 36 3155 0.02% 37 3194 0.02% 38 3447 0.02% 39 3399 0.02% 40 3547 0.02% 41 3635 0.02% 42 3976 0.02% 43 3799 0.02% 44 4117 0.02% 45 4229 0.02% 46 4318 0.02% 47 4477 0.02% 48 4393 0.02% 49 4734 0.02% 50 4519 0.02% 51 5027 0.03% 52 5166 0.03% 53 5476 0.03% 54 5993 0.03% 55 5213 0.03% 56 5434 0.03% 57 5491 0.03% 58 5655 0.03% 59 5796 0.03% 60 5991 0.03% 61 6143 0.03% 62 6557 0.03% 63 6629 0.03% 64 6699 0.03% 65 7129 0.04% 66 7286 0.04% 67 7320 0.04% 68 7514 0.04% 69 7734 0.04% 70 8112 0.04% 71 8886 0.05% 72 8943 0.05% 73 9192 0.05% 74 9431 0.05% 75 9516 0.05% 76 6984 0.04% 77 7432 0.04% 78 8573 0.04% 79 9380 0.05% 80 10215 0.05% 81 10758 0.06% 82 11268 0.06% 83 12279 0.06% 84 12856 0.07% 85 13643 0.07% 86 14317 0.07% 87 15453 0.08% 88 16800 0.09% 89 18555 0.10% 90 19993 0.10% 91 22214 0.12% 92 25174 0.13% 93 28753 0.15% 94 33694 0.17% 95 39522 0.20% 96 46490 0.24% 97 55420 0.29% 98 63094 0.33% 99 64120 0.33% 100 18452194 95.67% 19287228 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=27 prefix-density=0.03 prefix-fanout=4.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=289.60 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:18:23 Started mapping on | Feb 11 22:18:24 Finished on | Feb 11 22:18:51 Mapping speed, Million of reads per hour | 2571.63 Number of input reads | 19287228 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18180580 Uniquely mapped reads % | 94.26% Average mapped length | 98.95 Number of splices: Total | 5105405 Number of splices: Annotated (sjdb) | 4996977 Number of splices: GT/AG | 5028806 Number of splices: GC/AG | 62211 Number of splices: AT/AC | 5818 Number of splices: Non-canonical | 8570 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417796 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 74929 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 688852 688852 688852 N_multimapping 417796 417796 417796 N_noFeature 937636 9461570 9525209 N_ambiguous 197888 32944 33749 UnstrandedReadsAssigned:17045056 PositiveStrandReadsAssigned:8686066 NegativeStrandReadsAssigned:8621622 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207975 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207975-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,287,228 reads, 17,461,482 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR3207975.ke.tsv 34699 SRR3207975.se.tsv 87100 total ==> SRR3207975.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 802 36.0837 Potri.005G024800.1.v4.1 1035 936 141 13.0063 Potri.004G059700.1.v4.1 961 862 26 2.60422 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 262.549 7.97063 Potri.016G087400.1.v4.1 270 171 677 341.825 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 34 1.75362 Potri.012G127500.1.v4.1 977 878 845 83.0948 ==> SRR3207975.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2304 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207975 completed mapping pipeline successfully