Starting /dee2/code/volunteer_pipeline.sh SRR3207976 current disk space = 3052428763136 free memory = 1580042312 SRR3207976 SRAfilesize c98b0bf609336b55d3cf5ae82fd7dc98 SRR3207976.sra SRR3207976.sra file validated SRR3207976 is single end SRR3207976 is conventional basespace SRR3207976 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207976_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11275 34.0 33.0 34.0 31.0 34.0 2 33.293 34.0 34.0 34.0 31.0 34.0 3 33.36125 34.0 34.0 34.0 31.0 34.0 4 36.41575 37.0 37.0 37.0 35.0 37.0 5 36.469 37.0 37.0 37.0 35.0 37.0 6 36.50275 37.0 37.0 37.0 35.0 37.0 7 36.4135 37.0 37.0 37.0 35.0 37.0 8 36.47475 37.0 37.0 37.0 35.0 37.0 9 38.39225 39.0 39.0 39.0 37.0 39.0 10-11 38.339875 39.0 39.0 39.0 37.0 39.0 12-13 38.341375 39.0 39.0 39.0 37.0 39.0 14-15 40.057874999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.990625 41.0 40.0 41.0 38.0 41.0 18-19 39.952124999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.89425 41.0 40.0 41.0 38.0 41.0 22-23 39.835875 41.0 40.0 41.0 38.0 41.0 24-25 39.787625000000006 41.0 40.0 41.0 38.0 41.0 26-27 39.788375 41.0 40.0 41.0 38.0 41.0 28-29 39.649375 41.0 40.0 41.0 37.5 41.0 30-31 39.36725 41.0 40.0 41.0 37.0 41.0 32-33 39.4345 41.0 40.0 41.0 37.0 41.0 34-35 39.348375000000004 41.0 40.0 41.0 37.0 41.0 36-37 39.31337499999999 41.0 39.0 41.0 37.0 41.0 38-39 39.1825 41.0 39.0 41.0 36.0 41.0 40-41 39.033500000000004 40.5 39.0 41.0 35.5 41.0 42-43 39.028875 40.5 39.0 41.0 36.0 41.0 44-45 38.897499999999994 40.5 39.0 41.0 35.5 41.0 46-47 38.985875 40.5 39.0 41.0 35.5 41.0 48-49 38.90125 40.5 39.0 41.0 35.0 41.0 50-51 38.996750000000006 41.0 39.0 41.0 35.0 41.0 52-53 39.067 41.0 39.0 41.0 35.5 41.0 54-55 39.004999999999995 41.0 39.0 41.0 35.0 41.0 56-57 38.80275 41.0 39.0 41.0 35.0 41.0 58-59 38.602125 40.5 38.0 41.0 35.0 41.0 60-61 38.3925 40.0 37.5 41.0 35.0 41.0 62-63 38.066125 40.0 37.0 41.0 34.5 41.0 64-65 37.763875 39.5 36.5 41.0 34.0 41.0 66-67 37.45125 39.0 36.0 41.0 34.0 41.0 68-69 37.024375 39.0 35.5 41.0 33.0 41.0 70-71 36.7 37.5 35.0 40.0 33.0 41.0 72-73 36.230999999999995 37.0 35.0 39.0 33.0 41.0 74-75 35.784 37.0 35.0 39.0 33.0 40.5 76-77 34.801 36.0 34.5 37.0 31.0 39.0 78-79 34.849500000000006 36.0 35.0 37.0 32.0 39.0 80-81 34.631375 35.0 35.0 37.0 32.0 39.0 82-83 34.274125 35.0 35.0 36.0 32.0 37.0 84-85 34.073875 35.0 35.0 36.0 32.0 37.0 86-87 33.81975 35.0 35.0 36.0 31.5 36.5 88-89 33.503625 35.0 34.0 35.0 31.0 36.0 90-91 33.429500000000004 35.0 34.0 35.0 31.0 36.0 92-93 33.3035 35.0 34.0 35.0 31.0 36.0 94-95 33.22525 35.0 34.0 35.0 31.0 36.0 96-97 33.055875 35.0 34.0 35.0 31.0 35.0 98-99 32.953875 35.0 34.0 35.0 31.0 35.0 100 32.8265 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 4.0 10 1.0 11 5.0 12 3.0 13 4.0 14 3.0 15 3.0 16 8.0 17 2.0 18 4.0 19 2.0 20 8.0 21 4.0 22 8.0 23 5.0 24 5.0 25 14.0 26 19.0 27 9.0 28 22.0 29 19.0 30 27.0 31 50.0 32 46.0 33 59.0 34 82.0 35 140.0 36 287.0 37 794.0 38 1813.0 39 548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.275000000000002 16.025 13.350000000000001 47.349999999999994 2 18.625 24.9 37.574999999999996 18.9 3 20.4 27.275 27.3 25.025 4 23.525 33.6 19.900000000000002 22.975 5 24.15603900975244 35.0587646911728 22.85571392848212 17.92948237059265 6 19.5 35.75 25.1 19.650000000000002 7 17.65 18.9 44.15 19.3 8 19.325 22.325 29.25 29.099999999999998 9 19.8 22.725 32.875 24.6 10-11 21.7 33.15 23.599999999999998 21.55 12-13 19.8875 26.5625 30.049999999999997 23.5 14-15 20.525 28.4 28.675 22.400000000000002 16-17 21.7 27.675 28.287499999999998 22.3375 18-19 21.125 27.3875 28.712500000000002 22.775000000000002 20-21 21.25 28.025 27.775 22.95 22-23 20.962500000000002 28.962500000000002 27.6125 22.4625 24-25 21.4160620465349 27.833375031273455 28.246184638478862 22.504378283712782 26-27 20.8625 28.0625 28.599999999999998 22.475 28-29 21.064495929868503 27.91484032561052 28.490920475892302 22.52974326862868 30-31 21.224643125469573 28.637615827698472 28.4748309541698 21.66291009266216 32-33 21.8625 28.125 28.462500000000002 21.55 34-35 21.337500000000002 28.4125 28.025 22.225 36-37 21.575 28.512500000000003 28.1375 21.775 38-39 22.525000000000002 28.849999999999998 27.437499999999996 21.1875 40-41 21.525 27.925 28.512500000000003 22.037499999999998 42-43 21.85 28.225 27.9125 22.0125 44-45 20.674999999999997 28.3875 28.449999999999996 22.4875 46-47 21.987499999999997 28.0875 27.525 22.400000000000002 48-49 21.1125 28.6375 27.825 22.425 50-51 22.2625 28.1125 27.775 21.85 52-53 21.8125 28.175 28.075 21.9375 54-55 21.5375 28.487499999999997 27.700000000000003 22.275 56-57 22.0125 27.5875 27.625 22.775000000000002 58-59 20.8625 28.012500000000003 28.975 22.15 60-61 21.875 27.825 27.537499999999998 22.7625 62-63 21.825 28.1 28.425 21.65 64-65 22.112499999999997 28.7375 27.287499999999998 21.8625 66-67 21.875 28.025 28.3375 21.762500000000003 68-69 22.25 28.95 27.125 21.675 70-71 21.837500000000002 29.025000000000002 27.275 21.8625 72-73 21.325 28.65 27.750000000000004 22.275 74-75 21.9 28.262500000000003 27.975 21.8625 76-77 21.337500000000002 30.0375 26.8625 21.762500000000003 78-79 22.2625 27.9125 28.025 21.8 80-81 21.125 28.787499999999998 27.187499999999996 22.900000000000002 82-83 22.325 27.962500000000002 27.1 22.6125 84-85 22.5 28.225 28.075 21.2 86-87 21.9625 27.500000000000004 28.875 21.6625 88-89 22.625 28.9875 27.3625 21.025 90-91 21.6 28.175 28.249999999999996 21.975 92-93 22.05 27.55 28.1 22.3 94-95 22.912499999999998 26.937499999999996 28.4 21.75 96-97 21.8625 27.650000000000002 28.6375 21.85 98-99 22.3 27.875 28.025 21.8 100 21.349999999999998 27.700000000000003 28.675 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 2.0 25 2.0 26 2.5 27 6.5 28 10.0 29 12.5 30 18.0 31 23.5 32 40.5 33 56.0 34 55.5 35 60.5 36 90.5 37 131.0 38 145.5 39 166.5 40 201.0 41 215.5 42 221.0 43 256.5 44 284.0 45 286.0 46 272.0 47 242.5 48 225.0 49 208.0 50 175.5 51 135.0 52 102.5 53 83.0 54 64.5 55 38.5 56 33.0 57 37.5 58 26.5 59 13.5 60 10.0 61 9.5 62 7.5 63 5.5 64 5.0 65 3.0 66 2.0 67 2.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.075 26-27 0.0 28-29 0.1875 30-31 0.17500000000000002 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8997493734336 99.65 2 0.07518796992481204 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02506265664160401 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 8 0.2 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761468 spots for SRR3207976.sra Written 761468 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra Read 761467 spots for SRR3207976.sra Written 761467 spots for SRR3207976.sra SRR ids: ['SRR3207976.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dvb5f0cm SRR3207976.sra spots: 15229341 blocks: [[1, 761467], [761468, 1522934], [1522935, 2284401], [2284402, 3045868], [3045869, 3807335], [3807336, 4568802], [4568803, 5330269], [5330270, 6091736], [6091737, 6853203], [6853204, 7614670], [7614671, 8376137], [8376138, 9137604], [9137605, 9899071], [9899072, 10660538], [10660539, 11422005], [11422006, 12183472], [12183473, 12944939], [12944940, 13706406], [13706407, 14467873], [14467874, 15229341]] SRR3207976 file size 3952519 SRR3207976 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207976 SRR3207976_1.fastq Input file: SRR3207976_1.fastq trimmed: SRR3207976-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:39:37 2025 >> started Tue Feb 11 22:39:44 2025 >> done (7.518s) 15229341 reads processed; of these: 3343 ( 0.02%) short reads filtered out after trimming by size control 72609 ( 0.48%) empty reads filtered out after trimming by size control 15153389 (99.50%) reads available; of these: 662100 ( 4.37%) trimmed reads available after processing 14491289 (95.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 432 0.00% 19 484 0.00% 20 507 0.00% 21 649 0.00% 22 844 0.01% 23 1188 0.01% 24 1553 0.01% 25 1926 0.01% 26 2452 0.02% 27 2187 0.01% 28 2043 0.01% 29 2035 0.01% 30 2141 0.01% 31 2124 0.01% 32 2299 0.02% 33 2360 0.02% 34 2410 0.02% 35 2407 0.02% 36 2569 0.02% 37 2575 0.02% 38 2746 0.02% 39 2710 0.02% 40 2907 0.02% 41 2989 0.02% 42 3094 0.02% 43 3236 0.02% 44 3228 0.02% 45 3291 0.02% 46 3516 0.02% 47 3540 0.02% 48 3573 0.02% 49 3856 0.03% 50 3798 0.03% 51 4005 0.03% 52 4167 0.03% 53 4566 0.03% 54 5066 0.03% 55 4117 0.03% 56 4353 0.03% 57 4413 0.03% 58 4629 0.03% 59 4775 0.03% 60 4854 0.03% 61 4963 0.03% 62 5312 0.04% 63 5267 0.03% 64 5569 0.04% 65 6717 0.04% 66 6014 0.04% 67 5874 0.04% 68 6248 0.04% 69 6314 0.04% 70 6771 0.04% 71 7826 0.05% 72 7498 0.05% 73 7393 0.05% 74 7263 0.05% 75 7259 0.05% 76 5390 0.04% 77 5947 0.04% 78 6724 0.04% 79 7408 0.05% 80 7924 0.05% 81 8271 0.05% 82 8802 0.06% 83 9826 0.06% 84 10142 0.07% 85 10762 0.07% 86 11078 0.07% 87 11886 0.08% 88 12987 0.09% 89 14353 0.09% 90 15766 0.10% 91 17580 0.12% 92 19511 0.13% 93 22517 0.15% 94 26128 0.17% 95 30717 0.20% 96 36793 0.24% 97 43325 0.29% 98 49105 0.32% 99 50256 0.33% 100 14491289 95.63% 15153389 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=24 prefix-density=0.03 prefix-fanout=4.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=279.97 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:40:02 Started mapping on | Feb 11 22:40:03 Finished on | Feb 11 22:40:18 Mapping speed, Million of reads per hour | 3636.81 Number of input reads | 15153389 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14552618 Uniquely mapped reads % | 96.04% Average mapped length | 98.93 Number of splices: Total | 4179890 Number of splices: Annotated (sjdb) | 4100875 Number of splices: GT/AG | 4118143 Number of splices: GC/AG | 50683 Number of splices: AT/AC | 4405 Number of splices: Non-canonical | 6659 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 337139 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 39289 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.48% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 263632 263632 263632 N_multimapping 337139 337139 337139 N_noFeature 649836 7531469 7564831 N_ambiguous 156842 25322 25551 UnstrandedReadsAssigned:13745940 PositiveStrandReadsAssigned:6995827 NegativeStrandReadsAssigned:6962236 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207976 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207976-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,153,389 reads, 14,071,305 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR3207976.ke.tsv 34699 SRR3207976.se.tsv 87100 total ==> SRR3207976.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 509 28.2759 Potri.005G024800.1.v4.1 1035 936 61 6.94748 Potri.004G059700.1.v4.1 961 862 25 3.09176 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 205.43 7.70031 Potri.016G087400.1.v4.1 270 171 561 349.736 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 35 2.22888 Potri.012G127500.1.v4.1 977 878 1090 132.344 ==> SRR3207976.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1500 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 215 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207976 completed mapping pipeline successfully