Starting /dee2/code/volunteer_pipeline.sh SRR3207977 current disk space = 3052598988800 free memory = 1578039192 SRR3207977 SRAfilesize b96cbc3f60ce2095e0d18ea42ccc431f SRR3207977.sra SRR3207977.sra file validated SRR3207977 is single end SRR3207977 is conventional basespace SRR3207977 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207977_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.188 34.0 33.0 34.0 31.0 34.0 2 33.34925 34.0 34.0 34.0 31.0 34.0 3 33.36825 34.0 34.0 34.0 31.0 34.0 4 36.6325 37.0 37.0 37.0 35.0 37.0 5 36.53125 37.0 37.0 37.0 35.0 37.0 6 36.51575 37.0 37.0 37.0 35.0 37.0 7 36.50375 37.0 37.0 37.0 35.0 37.0 8 36.526 37.0 37.0 37.0 35.0 37.0 9 38.36025 39.0 39.0 39.0 37.0 39.0 10-11 38.421375 39.0 39.0 39.0 37.0 39.0 12-13 38.378375000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.92025 41.0 40.0 41.0 38.0 41.0 16-17 39.976124999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.97125 41.0 40.0 41.0 38.0 41.0 20-21 39.961875 41.0 40.0 41.0 38.0 41.0 22-23 39.946625 41.0 40.0 41.0 38.0 41.0 24-25 39.855375 41.0 40.0 41.0 38.0 41.0 26-27 39.775375 41.0 40.0 41.0 38.0 41.0 28-29 39.63175 41.0 40.0 41.0 38.0 41.0 30-31 39.464124999999996 41.0 40.0 41.0 37.0 41.0 32-33 39.434625 41.0 40.0 41.0 37.0 41.0 34-35 39.108000000000004 41.0 39.0 41.0 36.0 41.0 36-37 39.278875 41.0 39.5 41.0 37.0 41.0 38-39 39.159000000000006 41.0 39.0 41.0 36.0 41.0 40-41 39.118375 40.5 39.0 41.0 36.0 41.0 42-43 39.001625 40.5 39.0 41.0 35.0 41.0 44-45 38.812875000000005 41.0 39.0 41.0 35.0 41.0 46-47 38.833875000000006 41.0 39.0 41.0 35.0 41.0 48-49 38.71825 40.0 39.0 41.0 35.0 41.0 50-51 38.995875 41.0 39.0 41.0 35.0 41.0 52-53 39.044624999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.8165 41.0 39.0 41.0 35.0 41.0 56-57 38.652 41.0 39.0 41.0 35.0 41.0 58-59 38.451875 40.0 38.0 41.0 35.0 41.0 60-61 38.392875000000004 40.0 38.0 41.0 35.0 41.0 62-63 38.05825 40.0 37.0 41.0 34.5 41.0 64-65 37.751625000000004 39.5 37.0 41.0 34.0 41.0 66-67 37.292875 39.0 36.0 41.0 33.5 41.0 68-69 36.96125 39.0 35.5 41.0 33.0 41.0 70-71 36.58125 37.5 35.0 40.0 33.0 41.0 72-73 36.013374999999996 37.0 35.0 39.0 32.5 41.0 74-75 35.620000000000005 36.5 35.0 39.0 32.0 40.5 76-77 34.509875 35.5 34.0 37.0 30.0 39.0 78-79 34.623999999999995 35.5 35.0 37.0 31.0 39.0 80-81 34.390125 35.0 35.0 37.0 31.0 39.0 82-83 33.9765 35.0 35.0 36.0 31.0 37.0 84-85 33.597625 35.0 34.0 36.0 30.5 37.0 86-87 33.3775 35.0 34.0 35.5 30.0 36.5 88-89 33.17525 35.0 34.0 35.0 30.0 36.0 90-91 33.05075 35.0 34.0 35.0 30.0 36.0 92-93 32.80825 35.0 34.0 35.0 29.0 36.0 94-95 32.7175 35.0 34.0 35.0 29.0 36.0 96-97 32.532250000000005 35.0 34.0 35.0 29.0 35.0 98-99 32.406125 35.0 34.0 35.0 29.0 35.0 100 32.3245 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 2.0 9 3.0 10 1.0 11 1.0 12 4.0 13 1.0 14 7.0 15 3.0 16 5.0 17 2.0 18 6.0 19 4.0 20 7.0 21 7.0 22 10.0 23 9.0 24 9.0 25 12.0 26 13.0 27 17.0 28 25.0 29 32.0 30 36.0 31 51.0 32 55.0 33 71.0 34 95.0 35 142.0 36 279.0 37 766.0 38 1772.0 39 552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.075 15.85 12.8 47.275 2 18.725 23.200000000000003 39.95 18.125 3 19.950000000000003 27.200000000000003 28.525 24.325 4 23.875 32.1 21.75 22.275 5 24.012006003001503 35.967983991996 22.861430715357677 17.158579289644823 6 17.95 37.05 24.85 20.150000000000002 7 16.875 19.45 42.975 20.7 8 18.55 24.2 31.35 25.900000000000002 9 18.9 22.45 33.074999999999996 25.575 10-11 22.7125 32.5 24.05 20.7375 12-13 20.837500000000002 26.1625 29.875 23.125 14-15 21.025 27.8125 29.775000000000002 21.3875 16-17 22.25 28.549999999999997 27.187499999999996 22.0125 18-19 22.1375 28.4125 27.287499999999998 22.162499999999998 20-21 21.475 28.6125 27.775 22.1375 22-23 21.4875 28.125 28.525 21.8625 24-25 21.195448293109916 28.335625859697387 28.348130548955858 22.12079529823684 26-27 21.25 28.175 28.3625 22.2125 28-29 20.87087087087087 28.465965965965967 28.353353353353356 22.30980980980981 30-31 21.820230345518276 28.054581872809216 27.74161241862794 22.383575363044567 32-33 22.162499999999998 27.8625 27.775 22.2 34-35 21.675 28.125 28.3875 21.8125 36-37 21.1875 28.499999999999996 28.287499999999998 22.025 38-39 22.3375 27.775 28.4375 21.45 40-41 21.337500000000002 28.975 28.5875 21.099999999999998 42-43 22.3 27.3875 28.299999999999997 22.0125 44-45 21.4375 28.375 28.3625 21.825 46-47 21.775 28.15 27.925 22.15 48-49 21.912499999999998 28.95 27.425 21.712500000000002 50-51 21.625 28.9 27.675 21.8 52-53 21.837500000000002 29.475 27.4125 21.275 54-55 22.05 27.3375 28.1375 22.475 56-57 21.475 28.0625 28.262500000000003 22.2 58-59 21.875 28.9375 27.3 21.8875 60-61 21.2 28.65 28.575 21.575 62-63 21.7375 27.775 28.8625 21.625 64-65 22.0625 28.349999999999998 27.750000000000004 21.837500000000002 66-67 21.325 28.449999999999996 27.625 22.6 68-69 21.675 28.1375 28.8875 21.3 70-71 22.975 28.462500000000002 27.1125 21.45 72-73 22.6875 27.962500000000002 27.8875 21.462500000000002 74-75 22.112499999999997 28.075 27.6125 22.2 76-77 22.162499999999998 28.262500000000003 27.625 21.95 78-79 21.7 28.487499999999997 27.762500000000003 22.05 80-81 22.025 28.7375 28.037499999999998 21.2 82-83 21.8125 29.099999999999998 28.15 20.9375 84-85 22.5125 29.1125 26.637499999999996 21.7375 86-87 22.0125 28.262500000000003 28.7 21.025 88-89 22.025 27.737499999999997 28.499999999999996 21.7375 90-91 21.975 28.6625 27.250000000000004 22.112499999999997 92-93 21.525 27.5625 28.799999999999997 22.112499999999997 94-95 22.3125 28.6125 27.8375 21.2375 96-97 22.975 26.775 28.1 22.15 98-99 22.0125 27.962500000000002 28.3875 21.637500000000003 100 22.575 27.825 28.425 21.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 3.0 23 2.5 24 2.5 25 2.5 26 7.0 27 9.0 28 8.5 29 15.5 30 20.0 31 26.5 32 38.0 33 44.0 34 60.5 35 78.0 36 81.5 37 113.5 38 154.0 39 178.5 40 196.0 41 220.0 42 246.5 43 257.5 44 272.5 45 280.5 46 272.0 47 253.5 48 224.5 49 190.5 50 156.5 51 124.0 52 99.5 53 86.0 54 70.5 55 51.5 56 37.5 57 24.0 58 18.5 59 14.5 60 12.5 61 13.0 62 8.0 63 5.5 64 3.0 65 1.0 66 3.5 67 3.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.1 30-31 0.15 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795719 spots for SRR3207977.sra Written 795719 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra Read 795708 spots for SRR3207977.sra Written 795708 spots for SRR3207977.sra SRR ids: ['SRR3207977.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hz7bbtm7 SRR3207977.sra spots: 15914171 blocks: [[1, 795708], [795709, 1591416], [1591417, 2387124], [2387125, 3182832], [3182833, 3978540], [3978541, 4774248], [4774249, 5569956], [5569957, 6365664], [6365665, 7161372], [7161373, 7957080], [7957081, 8752788], [8752789, 9548496], [9548497, 10344204], [10344205, 11139912], [11139913, 11935620], [11935621, 12731328], [12731329, 13527036], [13527037, 14322744], [14322745, 15118452], [15118453, 15914171]] SRR3207977 file size 4130813 SRR3207977 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207977 SRR3207977_1.fastq Input file: SRR3207977_1.fastq trimmed: SRR3207977-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:45:14 2025 >> started Tue Feb 11 22:45:24 2025 >> done (10.608s) 15914171 reads processed; of these: 2551 ( 0.02%) short reads filtered out after trimming by size control 15658 ( 0.10%) empty reads filtered out after trimming by size control 15895962 (99.89%) reads available; of these: 713272 ( 4.49%) trimmed reads available after processing 15182690 (95.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 333 0.00% 19 463 0.00% 20 510 0.00% 21 650 0.00% 22 948 0.01% 23 1368 0.01% 24 1707 0.01% 25 2291 0.01% 26 2890 0.02% 27 2667 0.02% 28 2420 0.02% 29 2354 0.01% 30 2234 0.01% 31 2337 0.01% 32 2519 0.02% 33 2465 0.02% 34 2702 0.02% 35 2771 0.02% 36 2840 0.02% 37 2980 0.02% 38 3006 0.02% 39 3070 0.02% 40 3206 0.02% 41 3381 0.02% 42 3587 0.02% 43 3498 0.02% 44 3544 0.02% 45 3693 0.02% 46 3789 0.02% 47 3935 0.02% 48 3849 0.02% 49 4008 0.03% 50 3939 0.02% 51 4198 0.03% 52 4187 0.03% 53 4513 0.03% 54 4412 0.03% 55 4683 0.03% 56 4764 0.03% 57 4985 0.03% 58 4981 0.03% 59 5239 0.03% 60 5382 0.03% 61 5483 0.03% 62 5753 0.04% 63 5840 0.04% 64 5880 0.04% 65 5836 0.04% 66 6392 0.04% 67 6271 0.04% 68 6710 0.04% 69 6672 0.04% 70 7034 0.04% 71 7169 0.05% 72 7527 0.05% 73 7814 0.05% 74 8234 0.05% 75 8054 0.05% 76 5843 0.04% 77 6500 0.04% 78 7361 0.05% 79 8057 0.05% 80 8617 0.05% 81 9060 0.06% 82 9644 0.06% 83 10515 0.07% 84 10806 0.07% 85 11663 0.07% 86 12130 0.08% 87 12788 0.08% 88 14070 0.09% 89 15495 0.10% 90 17307 0.11% 91 19104 0.12% 92 21419 0.13% 93 24655 0.16% 94 28823 0.18% 95 33218 0.21% 96 39287 0.25% 97 46211 0.29% 98 51839 0.33% 99 54893 0.35% 100 15182690 95.51% 15895962 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=26 prefix-density=0.03 prefix-fanout=3.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=175.86 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=23.3 sequence=AAGAAGAAGAAA Started job on | Feb 11 22:45:42 Started mapping on | Feb 11 22:45:42 Finished on | Feb 11 22:46:01 Mapping speed, Million of reads per hour | 3011.87 Number of input reads | 15895962 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15111531 Uniquely mapped reads % | 95.07% Average mapped length | 98.91 Number of splices: Total | 4556316 Number of splices: Annotated (sjdb) | 4479535 Number of splices: GT/AG | 4489617 Number of splices: GC/AG | 55318 Number of splices: AT/AC | 4413 Number of splices: Non-canonical | 6968 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330198 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 42555 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454233 454233 454233 N_multimapping 330198 330198 330198 N_noFeature 611827 7781289 7841585 N_ambiguous 150249 24898 25055 UnstrandedReadsAssigned:14349455 PositiveStrandReadsAssigned:7305344 NegativeStrandReadsAssigned:7244891 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207977 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207977-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,895,962 reads, 14,663,344 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR3207977.ke.tsv 34699 SRR3207977.se.tsv 87100 total ==> SRR3207977.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 426 22.7501 Potri.005G024800.1.v4.1 1035 936 87 9.52561 Potri.004G059700.1.v4.1 961 862 10 1.18889 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 238.418 8.5913 Potri.016G087400.1.v4.1 270 171 451 270.29 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 42 2.57124 Potri.012G127500.1.v4.1 977 878 2022 236.013 ==> SRR3207977.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1630 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207977 completed mapping pipeline successfully