Starting /dee2/code/volunteer_pipeline.sh SRR3207978 current disk space = 3052617621504 free memory = 1492505244 SRR3207978 SRAfilesize 02a504b8deba70b9cfc34695d0ee809f SRR3207978.sra SRR3207978.sra file validated SRR3207978 is single end SRR3207978 is conventional basespace SRR3207978 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207978_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.167 34.0 33.0 34.0 31.0 34.0 2 33.30925 34.0 34.0 34.0 31.0 34.0 3 33.33925 34.0 34.0 34.0 31.0 34.0 4 36.6145 37.0 37.0 37.0 35.0 37.0 5 36.508 37.0 37.0 37.0 35.0 37.0 6 36.5125 37.0 37.0 37.0 35.0 37.0 7 36.469 37.0 37.0 37.0 35.0 37.0 8 36.5155 37.0 37.0 37.0 35.0 37.0 9 38.374 39.0 39.0 39.0 37.0 39.0 10-11 38.428375 39.0 39.0 39.0 37.0 39.0 12-13 38.365125 39.0 39.0 39.0 37.0 39.0 14-15 39.905375 41.0 40.0 41.0 38.0 41.0 16-17 39.9895 41.0 40.0 41.0 38.0 41.0 18-19 39.99525 41.0 40.0 41.0 38.0 41.0 20-21 39.99787499999999 41.0 40.0 41.0 38.0 41.0 22-23 39.921125 41.0 40.0 41.0 38.0 41.0 24-25 39.834 41.0 40.0 41.0 38.0 41.0 26-27 39.801 41.0 40.0 41.0 38.0 41.0 28-29 39.64775 41.0 40.0 41.0 38.0 41.0 30-31 39.503625 41.0 40.0 41.0 37.5 41.0 32-33 39.482749999999996 41.0 40.0 41.0 37.0 41.0 34-35 39.23325 41.0 39.5 41.0 36.0 41.0 36-37 39.25775 41.0 39.0 41.0 36.5 41.0 38-39 39.182 41.0 39.0 41.0 36.0 41.0 40-41 39.1405 41.0 39.0 41.0 36.0 41.0 42-43 38.997249999999994 40.5 39.0 41.0 35.0 41.0 44-45 38.880875 41.0 39.0 41.0 35.0 41.0 46-47 38.88475 40.5 39.0 41.0 35.0 41.0 48-49 38.808499999999995 40.0 39.0 41.0 35.0 41.0 50-51 39.025999999999996 41.0 39.0 41.0 35.5 41.0 52-53 38.981 41.0 39.0 41.0 35.0 41.0 54-55 38.830124999999995 41.0 39.0 41.0 35.0 41.0 56-57 38.71125 40.5 38.5 41.0 35.0 41.0 58-59 38.439375 40.0 38.0 41.0 35.0 41.0 60-61 38.31575 40.0 37.5 41.0 34.5 41.0 62-63 37.94075 40.0 37.0 41.0 34.0 41.0 64-65 37.655875 39.0 36.5 41.0 34.0 41.0 66-67 37.154624999999996 39.0 36.0 41.0 33.0 41.0 68-69 36.85875 38.5 35.5 40.5 33.0 41.0 70-71 36.285624999999996 37.0 35.0 39.5 32.0 41.0 72-73 35.835875 37.0 35.0 39.0 32.0 41.0 74-75 35.440625 36.5 35.0 39.0 32.0 40.5 76-77 34.253875 35.5 34.0 37.0 29.5 39.0 78-79 34.378125 35.5 35.0 37.0 30.5 39.0 80-81 34.188875 35.0 35.0 37.0 31.0 38.0 82-83 33.844 35.0 34.5 36.0 31.0 37.0 84-85 33.505750000000006 35.0 34.0 36.0 30.0 37.0 86-87 33.350875 35.0 34.0 35.5 30.5 36.5 88-89 33.196 35.0 34.0 35.0 30.0 36.0 90-91 32.957750000000004 35.0 34.0 35.0 30.0 36.0 92-93 32.745125 35.0 34.0 35.0 29.0 36.0 94-95 32.486125 35.0 34.0 35.0 29.0 35.5 96-97 32.383125 35.0 34.0 35.0 29.0 35.0 98-99 32.273625 35.0 34.0 35.0 29.0 35.0 100 32.159 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 4.0 10 2.0 11 3.0 12 2.0 13 3.0 14 2.0 15 1.0 16 3.0 17 3.0 18 5.0 19 4.0 20 9.0 21 10.0 22 10.0 23 9.0 24 13.0 25 17.0 26 13.0 27 21.0 28 26.0 29 24.0 30 28.0 31 55.0 32 54.0 33 80.0 34 98.0 35 152.0 36 284.0 37 775.0 38 1756.0 39 531.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.575 15.45 14.649999999999999 46.325 2 19.575 22.35 39.074999999999996 19.0 3 20.849999999999998 27.1 28.125 23.925 4 24.175 32.125 21.3 22.400000000000002 5 24.224999999999998 34.449999999999996 22.775000000000002 18.55 6 18.45 37.075 24.375 20.1 7 17.275 17.75 44.375 20.599999999999998 8 19.625 23.75 29.549999999999997 27.075 9 19.425 22.975 32.175 25.424999999999997 10-11 22.2 33.9875 23.05 20.7625 12-13 20.8 27.287499999999998 29.775000000000002 22.1375 14-15 20.1625 28.299999999999997 28.787499999999998 22.75 16-17 22.3875 28.675 26.5125 22.425 18-19 22.775000000000002 28.9375 26.650000000000002 21.637500000000003 20-21 22.4375 28.825 26.8625 21.875 22-23 21.1375 29.1625 26.687499999999996 23.0125 24-25 21.65270658832354 27.715964495561945 29.016127015876986 21.61520190023753 26-27 21.65 28.375 27.1625 22.8125 28-29 21.115139392424055 28.041005125640705 28.053506688336043 22.7903487935992 30-31 21.338336460287678 27.82989368355222 28.167604752970604 22.664165103189493 32-33 21.3625 28.975 27.250000000000004 22.412499999999998 34-35 21.912499999999998 28.299999999999997 27.250000000000004 22.537499999999998 36-37 21.6625 28.025 28.575 21.7375 38-39 22.9625 27.725 27.05 22.2625 40-41 22.45 29.175 27.4125 20.962500000000002 42-43 21.462500000000002 27.85 28.349999999999998 22.3375 44-45 21.75 27.287499999999998 28.512500000000003 22.45 46-47 23.1625 27.700000000000003 27.675 21.462500000000002 48-49 21.85 28.95 27.787499999999998 21.4125 50-51 22.237499999999997 28.175 27.400000000000002 22.1875 52-53 22.1375 27.975 28.0625 21.825 54-55 21.725 28.1125 27.85 22.3125 56-57 21.8875 27.975 28.475 21.6625 58-59 21.9625 27.6625 27.700000000000003 22.675 60-61 22.537499999999998 27.575 28.287499999999998 21.6 62-63 22.85 27.625 28.287499999999998 21.2375 64-65 23.0875 28.1875 27.55 21.175 66-67 21.925 28.349999999999998 27.1375 22.5875 68-69 21.637500000000003 28.262500000000003 27.275 22.825 70-71 21.85 28.775000000000002 27.375 22.0 72-73 21.837500000000002 27.775 28.6875 21.7 74-75 22.2 28.1125 28.287499999999998 21.4 76-77 22.650000000000002 28.075 27.474999999999998 21.8 78-79 21.8 29.125 26.5875 22.4875 80-81 22.1 28.012500000000003 27.787499999999998 22.1 82-83 21.712500000000002 28.475 28.15 21.6625 84-85 22.0625 26.950000000000003 28.599999999999998 22.3875 86-87 22.1375 27.8625 28.3875 21.6125 88-89 23.599999999999998 27.437499999999996 27.375 21.587500000000002 90-91 22.95 27.625 28.1375 21.2875 92-93 22.3875 28.3625 27.725 21.525 94-95 22.5625 28.000000000000004 28.825 20.6125 96-97 22.537499999999998 28.249999999999996 27.787499999999998 21.425 98-99 22.325 28.425 27.800000000000004 21.45 100 21.825 28.575 27.800000000000004 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 3.5 27 5.5 28 7.0 29 11.5 30 17.0 31 28.0 32 41.5 33 45.5 34 50.5 35 65.5 36 86.0 37 103.5 38 126.0 39 164.0 40 204.5 41 227.5 42 240.5 43 262.0 44 282.0 45 280.5 46 266.5 47 246.0 48 224.0 49 198.5 50 164.0 51 136.0 52 117.5 53 94.5 54 79.5 55 61.5 56 35.5 57 24.5 58 14.5 59 10.5 60 10.0 61 12.5 62 11.0 63 4.5 64 6.5 65 7.0 66 2.5 67 2.0 68 2.5 69 2.5 70 2.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0125 30-31 0.0625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72382626161185 99.3 2 0.25106703489831783 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025106703489831784 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 4 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720630 spots for SRR3207978.sra Written 720630 spots for SRR3207978.sra Read 720638 spots for SRR3207978.sra Written 720638 spots for SRR3207978.sra SRR ids: ['SRR3207978.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_63m3yw6w SRR3207978.sra spots: 14412608 blocks: [[1, 720630], [720631, 1441260], [1441261, 2161890], [2161891, 2882520], [2882521, 3603150], [3603151, 4323780], [4323781, 5044410], [5044411, 5765040], [5765041, 6485670], [6485671, 7206300], [7206301, 7926930], [7926931, 8647560], [8647561, 9368190], [9368191, 10088820], [10088821, 10809450], [10809451, 11530080], [11530081, 12250710], [12250711, 12971340], [12971341, 13691970], [13691971, 14412608]] SRR3207978 file size 3740032 SRR3207978 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207978 SRR3207978_1.fastq Input file: SRR3207978_1.fastq trimmed: SRR3207978-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:00:29 2025 >> started Tue Feb 11 22:00:36 2025 >> done (7.009s) 14412608 reads processed; of these: 3088 ( 0.02%) short reads filtered out after trimming by size control 46858 ( 0.33%) empty reads filtered out after trimming by size control 14362662 (99.65%) reads available; of these: 653964 ( 4.55%) trimmed reads available after processing 13708698 (95.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 354 0.00% 19 454 0.00% 20 1731 0.01% 21 691 0.00% 22 905 0.01% 23 1276 0.01% 24 1691 0.01% 25 2050 0.01% 26 2766 0.02% 27 2504 0.02% 28 2240 0.02% 29 2204 0.02% 30 2161 0.02% 31 2228 0.02% 32 2316 0.02% 33 2375 0.02% 34 2459 0.02% 35 2530 0.02% 36 2675 0.02% 37 2710 0.02% 38 2764 0.02% 39 2829 0.02% 40 2952 0.02% 41 3170 0.02% 42 3235 0.02% 43 3272 0.02% 44 3312 0.02% 45 3419 0.02% 46 3597 0.03% 47 3453 0.02% 48 3692 0.03% 49 3725 0.03% 50 3547 0.02% 51 3851 0.03% 52 3871 0.03% 53 4085 0.03% 54 4248 0.03% 55 4296 0.03% 56 4401 0.03% 57 4578 0.03% 58 4756 0.03% 59 4941 0.03% 60 4918 0.03% 61 5101 0.04% 62 5174 0.04% 63 6224 0.04% 64 5454 0.04% 65 5549 0.04% 66 5732 0.04% 67 5885 0.04% 68 6408 0.04% 69 6214 0.04% 70 6421 0.04% 71 6533 0.05% 72 6931 0.05% 73 7159 0.05% 74 7277 0.05% 75 7284 0.05% 76 5339 0.04% 77 5705 0.04% 78 6825 0.05% 79 7182 0.05% 80 7758 0.05% 81 8276 0.06% 82 8872 0.06% 83 9669 0.07% 84 9915 0.07% 85 10662 0.07% 86 11146 0.08% 87 11676 0.08% 88 13041 0.09% 89 14155 0.10% 90 16051 0.11% 91 17286 0.12% 92 19584 0.14% 93 22073 0.15% 94 25816 0.18% 95 30188 0.21% 96 35635 0.25% 97 42119 0.29% 98 46629 0.32% 99 49784 0.35% 100 13708698 95.45% 14362662 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.87 fanout-score-rank=22 prefix-density=0.03 prefix-fanout=5.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=190.81 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=24.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 22:00:55 Started mapping on | Feb 11 22:00:55 Finished on | Feb 11 22:01:09 Mapping speed, Million of reads per hour | 3693.26 Number of input reads | 14362662 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13773322 Uniquely mapped reads % | 95.90% Average mapped length | 98.90 Number of splices: Total | 4011733 Number of splices: Annotated (sjdb) | 3939908 Number of splices: GT/AG | 3952880 Number of splices: GC/AG | 48272 Number of splices: AT/AC | 4085 Number of splices: Non-canonical | 6496 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308515 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 59528 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 280825 280825 280825 N_multimapping 308515 308515 308515 N_noFeature 586023 7100092 7156230 N_ambiguous 150465 23551 24118 UnstrandedReadsAssigned:13036834 PositiveStrandReadsAssigned:6649679 NegativeStrandReadsAssigned:6592974 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207978 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207978-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,362,662 reads, 13,351,846 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR3207978.ke.tsv 34699 SRR3207978.se.tsv 87100 total ==> SRR3207978.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 444 25.8223 Potri.005G024800.1.v4.1 1035 936 236 28.1399 Potri.004G059700.1.v4.1 961 862 15 1.94209 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 211.195 8.28784 Potri.016G087400.1.v4.1 270 171 481 313.932 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 38 2.53346 Potri.012G127500.1.v4.1 977 878 1264 160.672 ==> SRR3207978.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1571 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207978 completed mapping pipeline successfully