Starting /dee2/code/volunteer_pipeline.sh SRR3207979 current disk space = 3052495052800 free memory = 1503789704 SRR3207979 SRAfilesize 801834b87de94c660a6c95a0ab31834a SRR3207979.sra SRR3207979.sra file validated SRR3207979 is single end SRR3207979 is conventional basespace SRR3207979 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207979_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18975 34.0 33.0 34.0 31.0 34.0 2 33.2965 34.0 34.0 34.0 31.0 34.0 3 33.3225 34.0 34.0 34.0 31.0 34.0 4 36.62925 37.0 37.0 37.0 35.0 37.0 5 36.58125 37.0 37.0 37.0 35.0 37.0 6 36.5085 37.0 37.0 37.0 35.0 37.0 7 36.522 37.0 37.0 37.0 35.0 37.0 8 36.52025 37.0 37.0 37.0 35.0 37.0 9 38.35275 39.0 39.0 39.0 37.0 39.0 10-11 38.393375000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.387875 39.0 39.0 39.0 37.0 39.0 14-15 39.90875 41.0 40.0 41.0 38.0 41.0 16-17 40.029375 41.0 40.0 41.0 38.0 41.0 18-19 40.004625 41.0 40.0 41.0 38.0 41.0 20-21 39.965625 41.0 40.0 41.0 38.0 41.0 22-23 39.918625 41.0 40.0 41.0 38.0 41.0 24-25 39.84 41.0 40.0 41.0 38.0 41.0 26-27 39.769625000000005 41.0 40.0 41.0 37.5 41.0 28-29 39.672875000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.478625 41.0 40.0 41.0 37.0 41.0 32-33 39.534125 41.0 40.0 41.0 37.0 41.0 34-35 39.2215 41.0 39.0 41.0 36.0 41.0 36-37 39.260625000000005 41.0 39.0 41.0 36.5 41.0 38-39 39.114875 41.0 39.0 41.0 36.0 41.0 40-41 39.0735 40.0 39.0 41.0 36.0 41.0 42-43 39.029875000000004 40.5 39.0 41.0 35.5 41.0 44-45 38.912 41.0 39.0 41.0 35.0 41.0 46-47 38.82675 40.5 39.0 41.0 35.0 41.0 48-49 38.787625 40.0 39.0 41.0 35.0 41.0 50-51 39.013875 41.0 39.0 41.0 35.5 41.0 52-53 39.0385 41.0 39.0 41.0 35.5 41.0 54-55 38.840625 41.0 39.0 41.0 35.0 41.0 56-57 38.666 40.5 38.5 41.0 35.0 41.0 58-59 38.379125 40.0 38.0 41.0 34.5 41.0 60-61 38.264375 40.0 38.0 41.0 34.0 41.0 62-63 37.9865 40.0 37.0 41.0 34.0 41.0 64-65 37.725375 39.5 36.5 41.0 34.0 41.0 66-67 37.284625000000005 39.0 36.0 41.0 33.5 41.0 68-69 36.974125 39.0 35.5 40.5 33.5 41.0 70-71 36.518625 37.5 35.0 40.0 33.0 41.0 72-73 35.913624999999996 37.0 35.0 39.0 32.0 41.0 74-75 35.5065 36.5 35.0 39.0 32.0 40.5 76-77 34.385 35.5 34.0 37.0 30.0 39.0 78-79 34.532875 35.0 35.0 37.0 31.0 39.0 80-81 34.268 35.0 35.0 37.0 31.0 39.0 82-83 33.910250000000005 35.0 34.5 36.0 31.0 37.0 84-85 33.651375 35.0 34.0 36.0 31.0 37.0 86-87 33.364875 35.0 34.0 35.5 30.5 36.5 88-89 33.19725 35.0 34.0 35.0 30.5 36.0 90-91 32.980625 35.0 34.0 35.0 30.0 36.0 92-93 32.785375 35.0 34.0 35.0 29.5 36.0 94-95 32.609 35.0 34.0 35.0 29.0 36.0 96-97 32.4745 35.0 34.0 35.0 29.0 35.0 98-99 32.338499999999996 35.0 34.0 35.0 29.0 35.0 100 32.24725 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 4.0 11 3.0 12 2.0 13 4.0 14 6.0 15 4.0 16 4.0 17 4.0 18 5.0 19 10.0 20 7.0 21 6.0 22 9.0 23 10.0 24 6.0 25 17.0 26 21.0 27 16.0 28 23.0 29 28.0 30 30.0 31 42.0 32 50.0 33 69.0 34 99.0 35 148.0 36 296.0 37 776.0 38 1717.0 39 582.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.6 16.325 13.05 48.025 2 19.325 23.724999999999998 38.775 18.175 3 19.125 27.825 28.549999999999997 24.5 4 21.4 32.525 21.45 24.625 5 23.980995248812203 35.20880220055014 22.13053263315829 18.67966991747937 6 17.7 38.125 25.15 19.025 7 17.125 18.65 44.1 20.125 8 18.275 23.7 31.900000000000002 26.125 9 20.925 22.075 32.375 24.625 10-11 22.287499999999998 33.5125 23.125 21.075 12-13 21.075 26.437500000000004 29.562500000000004 22.925 14-15 20.1625 28.262500000000003 29.25 22.325 16-17 21.875 27.9125 27.4125 22.8 18-19 21.375 28.4375 26.825 23.3625 20-21 21.7 28.9 27.35 22.05 22-23 21.325 29.225 27.325 22.125 24-25 21.315164395549445 28.82860357544693 27.69096137017127 22.165270658832352 26-27 21.099999999999998 28.762500000000003 28.1625 21.975 28-29 22.24862431215608 27.5887943971986 27.60130065032516 22.56128064032016 30-31 20.47047047047047 28.703703703703702 28.59109109109109 22.234734734734733 32-33 21.625 28.8625 27.4125 22.1 34-35 22.425 28.375 27.3375 21.8625 36-37 22.0625 28.325 27.725 21.8875 38-39 22.4625 27.9375 27.962500000000002 21.637500000000003 40-41 20.849999999999998 28.875 27.700000000000003 22.575 42-43 22.175 27.5125 28.1375 22.175 44-45 20.8 28.175 28.462500000000002 22.5625 46-47 21.512500000000003 28.575 27.212500000000002 22.7 48-49 22.175 27.762500000000003 28.1375 21.925 50-51 22.1 27.675 27.85 22.375 52-53 21.625 28.1 28.037499999999998 22.237499999999997 54-55 21.475 27.787499999999998 28.599999999999998 22.1375 56-57 22.162499999999998 28.037499999999998 27.900000000000002 21.9 58-59 22.025 29.012500000000003 28.000000000000004 20.962500000000002 60-61 21.725 27.6375 27.787499999999998 22.85 62-63 21.825 28.212500000000002 27.6625 22.3 64-65 21.712500000000002 28.1375 28.625 21.525 66-67 21.575 27.775 28.050000000000004 22.6 68-69 21.925 28.5875 27.750000000000004 21.7375 70-71 21.637500000000003 28.425 27.5625 22.375 72-73 21.462500000000002 27.800000000000004 28.475 22.2625 74-75 21.912499999999998 28.775000000000002 27.200000000000003 22.112499999999997 76-77 21.7375 28.425 28.199999999999996 21.637500000000003 78-79 21.837500000000002 29.049999999999997 27.3625 21.75 80-81 21.3875 28.975 27.85 21.7875 82-83 22.275 28.1 27.6 22.025 84-85 21.475 28.7375 28.375 21.4125 86-87 21.775 28.549999999999997 28.075 21.6 88-89 21.6625 28.299999999999997 27.0875 22.95 90-91 21.912499999999998 28.349999999999998 27.925 21.8125 92-93 22.1375 27.9375 28.462500000000002 21.462500000000002 94-95 22.475 27.5875 28.299999999999997 21.637500000000003 96-97 22.3625 27.5125 28.5625 21.5625 98-99 21.3 27.85 28.812500000000004 22.037499999999998 100 22.85 26.825 28.050000000000004 22.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 1.5 24 3.0 25 2.0 26 3.5 27 6.5 28 11.0 29 20.0 30 22.0 31 23.5 32 36.0 33 45.5 34 55.5 35 72.0 36 103.5 37 126.5 38 125.0 39 144.0 40 192.0 41 230.5 42 253.0 43 274.5 44 278.5 45 266.5 46 249.5 47 248.0 48 238.5 49 201.5 50 165.5 51 134.5 52 106.0 53 83.0 54 73.0 55 51.5 56 27.0 57 27.5 58 22.5 59 14.5 60 14.5 61 10.0 62 7.0 63 4.5 64 2.5 65 3.5 66 3.5 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 1.0 76 1.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.05 30-31 0.1 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77381251570746 99.25 2 0.17592359889419454 0.35000000000000003 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025131942699170642 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 13 0.325 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.1375 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626520 spots for SRR3207979.sra Written 626520 spots for SRR3207979.sra Read 626531 spots for SRR3207979.sra Written 626531 spots for SRR3207979.sra SRR ids: ['SRR3207979.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t6h3uxc0 SRR3207979.sra spots: 12530411 blocks: [[1, 626520], [626521, 1253040], [1253041, 1879560], [1879561, 2506080], [2506081, 3132600], [3132601, 3759120], [3759121, 4385640], [4385641, 5012160], [5012161, 5638680], [5638681, 6265200], [6265201, 6891720], [6891721, 7518240], [7518241, 8144760], [8144761, 8771280], [8771281, 9397800], [9397801, 10024320], [10024321, 10650840], [10650841, 11277360], [11277361, 11903880], [11903881, 12530411]] SRR3207979 file size 3250192 SRR3207979 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207979 SRR3207979_1.fastq Input file: SRR3207979_1.fastq trimmed: SRR3207979-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:07:23 2025 >> started Tue Feb 11 22:07:30 2025 >> done (6.278s) 12530411 reads processed; of these: 2076 ( 0.02%) short reads filtered out after trimming by size control 39540 ( 0.32%) empty reads filtered out after trimming by size control 12488795 (99.67%) reads available; of these: 554774 ( 4.44%) trimmed reads available after processing 11934021 (95.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 280 0.00% 19 323 0.00% 20 382 0.00% 21 533 0.00% 22 730 0.01% 23 1016 0.01% 24 1350 0.01% 25 1770 0.01% 26 2227 0.02% 27 2159 0.02% 28 1949 0.02% 29 1928 0.02% 30 1836 0.01% 31 1802 0.01% 32 1900 0.02% 33 2001 0.02% 34 2125 0.02% 35 2095 0.02% 36 2151 0.02% 37 2319 0.02% 38 2362 0.02% 39 2353 0.02% 40 2410 0.02% 41 2610 0.02% 42 2644 0.02% 43 2691 0.02% 44 2886 0.02% 45 2901 0.02% 46 2976 0.02% 47 3057 0.02% 48 3044 0.02% 49 3218 0.03% 50 3192 0.03% 51 3181 0.03% 52 3375 0.03% 53 3504 0.03% 54 3491 0.03% 55 3733 0.03% 56 3746 0.03% 57 4004 0.03% 58 4028 0.03% 59 4161 0.03% 60 4151 0.03% 61 4339 0.03% 62 4390 0.04% 63 4687 0.04% 64 4624 0.04% 65 4724 0.04% 66 4844 0.04% 67 5090 0.04% 68 5600 0.04% 69 5438 0.04% 70 5701 0.05% 71 5468 0.04% 72 5931 0.05% 73 6036 0.05% 74 6255 0.05% 75 6297 0.05% 76 4589 0.04% 77 5187 0.04% 78 5735 0.05% 79 6020 0.05% 80 6728 0.05% 81 6966 0.06% 82 7559 0.06% 83 8186 0.07% 84 8377 0.07% 85 8990 0.07% 86 9408 0.08% 87 10067 0.08% 88 11073 0.09% 89 11874 0.10% 90 13254 0.11% 91 14845 0.12% 92 16577 0.13% 93 18913 0.15% 94 21861 0.18% 95 25684 0.21% 96 30471 0.24% 97 35994 0.29% 98 40135 0.32% 99 42263 0.34% 100 11934021 95.56% 12488795 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=8.51 fanout-score-rank=17 prefix-density=0.06 prefix-fanout=8.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=280.78 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:07:46 Started mapping on | Feb 11 22:07:46 Finished on | Feb 11 22:08:05 Mapping speed, Million of reads per hour | 2366.30 Number of input reads | 12488795 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11610813 Uniquely mapped reads % | 92.97% Average mapped length | 98.93 Number of splices: Total | 3474248 Number of splices: Annotated (sjdb) | 3414391 Number of splices: GT/AG | 3422374 Number of splices: GC/AG | 43123 Number of splices: AT/AC | 3498 Number of splices: Non-canonical | 5253 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257875 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 32545 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.70% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 620107 620107 620107 N_multimapping 257875 257875 257875 N_noFeature 485295 5980979 6036814 N_ambiguous 116405 18908 19362 UnstrandedReadsAssigned:11009113 PositiveStrandReadsAssigned:5610926 NegativeStrandReadsAssigned:5554637 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207979 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207979-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,488,795 reads, 11,247,286 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR3207979.ke.tsv 34699 SRR3207979.se.tsv 87100 total ==> SRR3207979.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 315 21.4623 Potri.005G024800.1.v4.1 1035 936 84 11.7339 Potri.004G059700.1.v4.1 961 862 15 2.27522 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 153.187 7.0426 Potri.016G087400.1.v4.1 270 171 377 288.261 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27 2.10886 Potri.012G127500.1.v4.1 977 878 1860 276.986 ==> SRR3207979.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1096 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207979 completed mapping pipeline successfully