Starting /dee2/code/volunteer_pipeline.sh SRR3207980 current disk space = 3052224495616 free memory = 1414516892 SRR3207980 SRAfilesize 68f085faddcbf91558441f040d59f622 SRR3207980.sra SRR3207980.sra file validated SRR3207980 is single end SRR3207980 is conventional basespace SRR3207980 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207980_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91975 34.0 31.0 34.0 31.0 34.0 2 33.15375 34.0 33.0 34.0 31.0 34.0 3 33.26125 34.0 34.0 34.0 31.0 34.0 4 36.486 37.0 37.0 37.0 35.0 37.0 5 36.351 37.0 37.0 37.0 35.0 37.0 6 36.426 37.0 37.0 37.0 35.0 37.0 7 36.4055 37.0 37.0 37.0 35.0 37.0 8 36.444 37.0 37.0 37.0 35.0 37.0 9 38.249 39.0 39.0 39.0 37.0 39.0 10-11 38.2645 39.0 39.0 39.0 37.0 39.0 12-13 38.264375 39.0 39.0 39.0 37.0 39.0 14-15 39.917 41.0 40.0 41.0 38.0 41.0 16-17 39.920500000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.930499999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.864 41.0 40.0 41.0 38.0 41.0 22-23 39.505250000000004 41.0 40.0 41.0 36.5 41.0 24-25 39.77275 41.0 40.0 41.0 38.0 41.0 26-27 39.774875 41.0 40.0 41.0 38.0 41.0 28-29 39.727999999999994 41.0 40.0 41.0 38.0 41.0 30-31 39.52175 41.0 40.0 41.0 37.0 41.0 32-33 39.291875000000005 41.0 40.0 41.0 36.5 41.0 34-35 39.401125 41.0 40.0 41.0 37.0 41.0 36-37 39.343375 41.0 40.0 41.0 37.0 41.0 38-39 39.204125000000005 41.0 39.0 41.0 36.0 41.0 40-41 39.072375 40.5 39.0 41.0 35.5 41.0 42-43 39.138000000000005 40.5 39.0 41.0 36.0 41.0 44-45 39.154625 41.0 39.0 41.0 36.0 41.0 46-47 39.07175 41.0 39.0 41.0 35.5 41.0 48-49 38.900875 40.5 39.0 41.0 35.0 41.0 50-51 39.179625 41.0 39.0 41.0 36.0 41.0 52-53 39.226749999999996 41.0 39.0 41.0 36.0 41.0 54-55 39.00775 41.0 39.0 41.0 35.0 41.0 56-57 38.81925 41.0 38.5 41.0 35.0 41.0 58-59 38.4995 40.0 38.0 41.0 35.0 41.0 60-61 38.388125 40.0 38.0 41.0 35.0 41.0 62-63 38.276125 40.0 37.0 41.0 35.0 41.0 64-65 37.977375 39.5 36.5 41.0 34.0 41.0 66-67 37.640249999999995 39.0 36.0 41.0 34.0 41.0 68-69 37.272 39.0 36.0 41.0 34.0 41.0 70-71 36.910125 37.5 35.0 40.0 34.0 41.0 72-73 36.411625 37.0 35.0 39.0 34.0 41.0 74-75 35.83 37.0 35.0 39.0 33.0 40.5 76-77 34.910375 36.0 34.5 37.0 31.5 39.0 78-79 34.947374999999994 36.0 35.0 37.0 32.0 39.0 80-81 34.642375 35.0 35.0 37.0 32.0 39.0 82-83 34.403875 35.0 35.0 36.5 32.0 37.0 84-85 34.177 35.0 35.0 36.0 32.0 37.0 86-87 33.9405 35.0 35.0 36.0 32.0 36.5 88-89 33.339375000000004 35.0 34.0 35.0 30.5 36.0 90-91 33.400375 35.0 34.0 35.0 31.0 36.0 92-93 33.436125000000004 35.0 34.0 35.0 31.5 36.0 94-95 33.300375 35.0 34.0 35.0 31.0 36.0 96-97 33.161 35.0 34.0 35.0 31.0 35.5 98-99 33.027249999999995 35.0 34.0 35.0 31.0 35.0 100 32.87225 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 3.0 12 3.0 13 2.0 14 1.0 15 0.0 16 4.0 17 2.0 18 5.0 19 3.0 20 6.0 21 2.0 22 9.0 23 8.0 24 9.0 25 9.0 26 10.0 27 17.0 28 28.0 29 28.0 30 34.0 31 30.0 32 53.0 33 78.0 34 90.0 35 148.0 36 275.0 37 740.0 38 1804.0 39 593.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.0 16.125 16.150000000000002 42.725 2 20.025000000000002 24.075 37.025000000000006 18.875 3 19.775000000000002 27.875 28.449999999999996 23.9 4 23.5 33.725 20.325 22.45 5 24.406101525381345 34.733683420855215 22.58064516129032 18.27956989247312 6 19.3 36.75 25.45 18.5 7 17.125 19.475 42.449999999999996 20.95 8 18.925 23.25 29.925 27.900000000000002 9 19.7 23.175 32.574999999999996 24.55 10-11 22.3625 33.5 22.3 21.837500000000002 12-13 19.175 27.0625 30.012499999999996 23.75 14-15 22.1 27.212500000000002 27.925 22.7625 16-17 22.1 28.812500000000004 27.2625 21.825 18-19 21.0375 28.275 28.0875 22.6 20-21 22.0 28.725 27.6 21.675 22-23 21.712500000000002 29.1375 27.925 21.224999999999998 24-25 20.7625 28.287499999999998 28.462500000000002 22.4875 26-27 20.8 28.3625 28.125 22.7125 28-29 21.55 28.6625 28.175 21.6125 30-31 21.13028257064266 27.619404851212803 28.582145536384097 22.66816704176044 32-33 20.4875 29.75 27.900000000000002 21.8625 34-35 21.337500000000002 28.425 27.650000000000002 22.5875 36-37 21.55 28.349999999999998 27.5125 22.5875 38-39 21.3875 29.375 27.224999999999998 22.0125 40-41 21.3625 29.2 27.775 21.6625 42-43 21.55 28.237499999999997 27.700000000000003 22.5125 44-45 20.05 28.6375 28.7375 22.575 46-47 21.5625 28.775000000000002 27.237499999999997 22.425 48-49 20.75 28.6125 28.625 22.0125 50-51 22.0625 28.925 26.75 22.2625 52-53 20.9 28.95 27.8625 22.287499999999998 54-55 22.912499999999998 27.8625 27.987499999999997 21.2375 56-57 22.0125 28.462500000000002 27.0125 22.5125 58-59 21.4375 28.449999999999996 27.6625 22.45 60-61 22.112499999999997 26.775 28.8875 22.225 62-63 21.625 28.299999999999997 28.1125 21.9625 64-65 21.9 28.375 28.65 21.075 66-67 21.5375 28.3375 27.5625 22.5625 68-69 21.65 28.6125 28.037499999999998 21.7 70-71 21.525 28.4 27.5125 22.5625 72-73 20.8875 28.4 28.3125 22.400000000000002 74-75 22.125 28.449999999999996 27.925 21.5 76-77 21.637500000000003 28.3375 28.275 21.75 78-79 21.9625 27.962500000000002 28.212500000000002 21.8625 80-81 21.9 28.6375 27.1625 22.3 82-83 21.5625 28.5625 27.437499999999996 22.4375 84-85 22.125 27.6625 27.675 22.537499999999998 86-87 22.15 29.25 27.1625 21.4375 88-89 22.025 28.050000000000004 28.262500000000003 21.6625 90-91 21.224999999999998 28.4 27.900000000000002 22.475 92-93 22.412499999999998 28.6125 27.4125 21.5625 94-95 22.5125 28.449999999999996 27.700000000000003 21.337500000000002 96-97 21.925 28.3875 27.925 21.762500000000003 98-99 22.412499999999998 27.9125 27.8375 21.837500000000002 100 22.275 29.525000000000002 26.75 21.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.0 25 3.0 26 5.0 27 7.5 28 9.5 29 11.0 30 22.5 31 28.0 32 34.5 33 49.5 34 64.0 35 78.0 36 91.5 37 107.0 38 132.0 39 164.5 40 197.0 41 235.5 42 254.5 43 267.0 44 288.5 45 287.0 46 271.0 47 249.0 48 219.5 49 183.5 50 149.0 51 123.0 52 99.0 53 84.5 54 72.5 55 48.5 56 30.0 57 25.5 58 20.0 59 15.5 60 14.5 61 10.5 62 6.0 63 7.0 64 7.5 65 4.5 66 1.5 67 0.5 68 1.0 69 1.0 70 1.5 71 1.5 72 0.5 73 1.0 74 1.5 75 2.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84924623115577 99.35000000000001 2 0.10050251256281408 0.2 3 0.0 0.0 4 0.0 0.0 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02512562814070352 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 13 0.325 TruSeq Adapter, Index 18 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTA 5 0.125 TruSeq Adapter, Index 18 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.1875 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.21250000000000002 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.2375 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749230 spots for SRR3207980.sra Written 749230 spots for SRR3207980.sra Read 749240 spots for SRR3207980.sra Written 749240 spots for SRR3207980.sra SRR ids: ['SRR3207980.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_muckt2tr SRR3207980.sra spots: 14984610 blocks: [[1, 749230], [749231, 1498460], [1498461, 2247690], [2247691, 2996920], [2996921, 3746150], [3746151, 4495380], [4495381, 5244610], [5244611, 5993840], [5993841, 6743070], [6743071, 7492300], [7492301, 8241530], [8241531, 8990760], [8990761, 9739990], [9739991, 10489220], [10489221, 11238450], [11238451, 11987680], [11987681, 12736910], [12736911, 13486140], [13486141, 14235370], [14235371, 14984610]] SRR3207980 file size 3888772 SRR3207980 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207980 SRR3207980_1.fastq Input file: SRR3207980_1.fastq trimmed: SRR3207980-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:37:14 2025 >> started Tue Feb 11 22:37:21 2025 >> done (7.388s) 14984610 reads processed; of these: 2105 ( 0.01%) short reads filtered out after trimming by size control 81305 ( 0.54%) empty reads filtered out after trimming by size control 14901200 (99.44%) reads available; of these: 641885 ( 4.31%) trimmed reads available after processing 14259315 (95.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 341 0.00% 19 433 0.00% 20 560 0.00% 21 632 0.00% 22 836 0.01% 23 1052 0.01% 24 1404 0.01% 25 1823 0.01% 26 2151 0.01% 27 2374 0.02% 28 2165 0.01% 29 2360 0.02% 30 2329 0.02% 31 2197 0.01% 32 2462 0.02% 33 2629 0.02% 34 2443 0.02% 35 2468 0.02% 36 2564 0.02% 37 2551 0.02% 38 2513 0.02% 39 2815 0.02% 40 2917 0.02% 41 3247 0.02% 42 3164 0.02% 43 3081 0.02% 44 3181 0.02% 45 3384 0.02% 46 3430 0.02% 47 3510 0.02% 48 3769 0.03% 49 3844 0.03% 50 3713 0.02% 51 3915 0.03% 52 4228 0.03% 53 4377 0.03% 54 4351 0.03% 55 4413 0.03% 56 4736 0.03% 57 4982 0.03% 58 4944 0.03% 59 5066 0.03% 60 5243 0.04% 61 5383 0.04% 62 5713 0.04% 63 5718 0.04% 64 5691 0.04% 65 6180 0.04% 66 6165 0.04% 67 6181 0.04% 68 6560 0.04% 69 5896 0.04% 70 6693 0.04% 71 8016 0.05% 72 7415 0.05% 73 7148 0.05% 74 7249 0.05% 75 7357 0.05% 76 5156 0.03% 77 5697 0.04% 78 6436 0.04% 79 7052 0.05% 80 7565 0.05% 81 8093 0.05% 82 8556 0.06% 83 9274 0.06% 84 9703 0.07% 85 10094 0.07% 86 10668 0.07% 87 11808 0.08% 88 12734 0.09% 89 13784 0.09% 90 15261 0.10% 91 17103 0.11% 92 18908 0.13% 93 21386 0.14% 94 24965 0.17% 95 28843 0.19% 96 34072 0.23% 97 40002 0.27% 98 46205 0.31% 99 46558 0.31% 100 14259315 95.69% 14901200 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=43.71 fanout-score-rank=7 prefix-density=0.41 prefix-fanout=33.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=293.03 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:37:43 Started mapping on | Feb 11 22:37:43 Finished on | Feb 11 22:38:00 Mapping speed, Million of reads per hour | 3155.55 Number of input reads | 14901200 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14086650 Uniquely mapped reads % | 94.53% Average mapped length | 98.91 Number of splices: Total | 4230260 Number of splices: Annotated (sjdb) | 4155879 Number of splices: GT/AG | 4166749 Number of splices: GC/AG | 52583 Number of splices: AT/AC | 4135 Number of splices: Non-canonical | 6793 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314052 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 120643 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 500498 500498 500498 N_multimapping 314052 314052 314052 N_noFeature 602738 7261252 7327801 N_ambiguous 149037 24241 24701 UnstrandedReadsAssigned:13334875 PositiveStrandReadsAssigned:6801157 NegativeStrandReadsAssigned:6734148 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207980 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207980-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,901,200 reads, 13,713,724 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR3207980.ke.tsv 34699 SRR3207980.se.tsv 87100 total ==> SRR3207980.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 431 24.7225 Potri.005G024800.1.v4.1 1035 936 43 5.05688 Potri.004G059700.1.v4.1 961 862 21 2.68165 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 218.389 8.45261 Potri.016G087400.1.v4.1 270 171 449 289.028 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 70 4.60291 Potri.012G127500.1.v4.1 977 878 1429 179.155 ==> SRR3207980.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1876 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 60 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR3207980 completed mapping pipeline successfully