Starting /dee2/code/volunteer_pipeline.sh SRR3207981 current disk space = 3052336328704 free memory = 1579124300 SRR3207981 SRAfilesize ad60835ddb24ce46b3a4e5f479fc3a18 SRR3207981.sra SRR3207981.sra file validated SRR3207981 is single end SRR3207981 is conventional basespace SRR3207981 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207981_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0085 34.0 33.0 34.0 31.0 34.0 2 33.1805 34.0 34.0 34.0 31.0 34.0 3 33.30775 34.0 34.0 34.0 31.0 34.0 4 36.56425 37.0 37.0 37.0 35.0 37.0 5 36.413 37.0 37.0 37.0 35.0 37.0 6 36.469 37.0 37.0 37.0 35.0 37.0 7 36.461 37.0 37.0 37.0 35.0 37.0 8 36.514 37.0 37.0 37.0 35.0 37.0 9 38.30375 39.0 39.0 39.0 37.0 39.0 10-11 38.302875 39.0 39.0 39.0 37.0 39.0 12-13 38.3275 39.0 39.0 39.0 37.0 39.0 14-15 40.01975 41.0 40.0 41.0 38.0 41.0 16-17 40.03337500000001 41.0 40.0 41.0 38.0 41.0 18-19 40.001125 41.0 40.0 41.0 38.0 41.0 20-21 40.01 41.0 40.0 41.0 38.0 41.0 22-23 39.633875 41.0 40.0 41.0 37.5 41.0 24-25 39.846375 41.0 40.0 41.0 38.0 41.0 26-27 39.811499999999995 41.0 40.0 41.0 38.0 41.0 28-29 39.806 41.0 40.0 41.0 38.0 41.0 30-31 39.63125 41.0 40.0 41.0 37.0 41.0 32-33 39.403 41.0 40.0 41.0 37.0 41.0 34-35 39.51625 41.0 40.0 41.0 37.0 41.0 36-37 39.427125000000004 41.0 40.0 41.0 37.0 41.0 38-39 39.33 41.0 39.5 41.0 36.5 41.0 40-41 39.134625 41.0 39.0 41.0 36.0 41.0 42-43 39.1995 41.0 39.0 41.0 36.0 41.0 44-45 39.27125 41.0 39.0 41.0 36.5 41.0 46-47 39.17225 41.0 39.0 41.0 36.0 41.0 48-49 38.95675 40.5 39.0 41.0 35.0 41.0 50-51 39.215625 41.0 39.0 41.0 36.0 41.0 52-53 39.26325 41.0 39.0 41.0 36.0 41.0 54-55 39.05525 41.0 39.0 41.0 35.5 41.0 56-57 38.8685 41.0 39.0 41.0 35.0 41.0 58-59 38.640375 40.5 38.0 41.0 35.0 41.0 60-61 38.60625 40.0 38.0 41.0 35.0 41.0 62-63 38.374375 40.0 37.0 41.0 35.0 41.0 64-65 38.044 39.5 37.0 41.0 34.5 41.0 66-67 37.785875000000004 39.0 36.0 41.0 34.0 41.0 68-69 37.344125000000005 39.0 36.0 41.0 34.0 41.0 70-71 37.010125 37.5 35.0 40.0 34.0 41.0 72-73 36.482 37.0 35.0 39.0 34.0 41.0 74-75 36.027375 37.0 35.0 39.0 33.0 40.5 76-77 35.079125000000005 36.0 34.5 37.0 31.5 39.0 78-79 35.063874999999996 36.0 35.0 37.0 32.5 39.0 80-81 34.773625 35.0 35.0 37.0 32.0 39.0 82-83 34.5515 35.0 35.0 36.0 33.0 37.0 84-85 34.287 35.0 35.0 36.0 32.0 37.0 86-87 34.01875 35.0 35.0 36.0 32.0 36.5 88-89 33.496375 35.0 34.0 35.0 30.5 36.0 90-91 33.55225 35.0 34.0 35.0 31.0 36.0 92-93 33.479375000000005 35.0 34.5 35.0 31.5 36.0 94-95 33.412 35.0 34.5 35.0 31.5 36.0 96-97 33.293375 35.0 34.0 35.0 31.5 35.0 98-99 33.080375000000004 35.0 34.0 35.0 31.0 35.0 100 33.0875 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 2.0 14 3.0 15 0.0 16 2.0 17 7.0 18 2.0 19 2.0 20 4.0 21 1.0 22 4.0 23 8.0 24 0.0 25 7.0 26 14.0 27 10.0 28 26.0 29 29.0 30 28.0 31 46.0 32 58.0 33 70.0 34 87.0 35 147.0 36 252.0 37 760.0 38 1804.0 39 617.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.75 16.125 14.825 43.3 2 18.75 24.325 39.45 17.474999999999998 3 19.25 26.474999999999998 29.875 24.4 4 23.549999999999997 32.95 21.25 22.25 5 23.1 35.425000000000004 22.525000000000002 18.95 6 18.3 36.925000000000004 24.95 19.825 7 17.65 19.15 42.65 20.549999999999997 8 18.875 22.55 29.65 28.925 9 18.775 23.3 32.5 25.424999999999997 10-11 22.775000000000002 32.9 22.375 21.95 12-13 19.725 26.5375 29.725 24.0125 14-15 20.150000000000002 28.237499999999997 27.650000000000002 23.962500000000002 16-17 21.0 28.9 27.275 22.825 18-19 21.6875 28.0875 27.250000000000004 22.975 20-21 21.55 27.6625 27.8875 22.900000000000002 22-23 21.349999999999998 28.9 27.925 21.825 24-25 21.5625 27.825 28.549999999999997 22.0625 26-27 21.05 28.425 28.199999999999996 22.325 28-29 21.792948237059264 28.28207051762941 28.244561140285075 21.680420105026258 30-31 21.152644080510065 28.041005125640705 28.50356294536817 22.30278784848106 32-33 20.95 28.6625 27.1 23.2875 34-35 22.3125 27.8875 27.8125 21.987499999999997 36-37 21.4 28.625 27.500000000000004 22.475 38-39 20.6375 27.900000000000002 28.4 23.0625 40-41 22.2 27.9125 26.937499999999996 22.95 42-43 20.5875 28.812500000000004 28.9125 21.6875 44-45 21.625 27.6875 28.675 22.0125 46-47 21.512500000000003 27.762500000000003 27.6375 23.0875 48-49 20.875 29.575000000000003 27.787499999999998 21.762500000000003 50-51 21.762500000000003 28.462500000000002 28.1375 21.637500000000003 52-53 22.2625 27.6375 27.1625 22.9375 54-55 22.8875 28.0875 27.224999999999998 21.8 56-57 21.3625 28.375 28.525 21.7375 58-59 22.5125 28.1 27.5625 21.825 60-61 21.9625 27.800000000000004 27.762500000000003 22.475 62-63 22.1 28.7 27.5625 21.637500000000003 64-65 22.112499999999997 28.4375 27.450000000000003 22.0 66-67 21.275 28.975 27.950000000000003 21.8 68-69 21.8 28.9875 27.8125 21.4 70-71 21.712500000000002 27.8625 27.712500000000002 22.7125 72-73 21.349999999999998 28.4125 27.6875 22.55 74-75 21.5625 28.4 27.775 22.2625 76-77 22.55 28.287499999999998 27.487499999999997 21.675 78-79 21.075 28.5875 28.5625 21.775 80-81 21.762500000000003 28.7375 27.3 22.2 82-83 21.1625 28.812500000000004 27.750000000000004 22.275 84-85 21.675 28.075 28.599999999999998 21.65 86-87 22.0625 29.3875 27.1375 21.4125 88-89 22.5 28.549999999999997 26.7625 22.1875 90-91 21.6625 28.749999999999996 28.175 21.4125 92-93 22.912499999999998 27.8625 27.825 21.4 94-95 22.45 29.4125 26.924999999999997 21.212500000000002 96-97 22.4625 29.275000000000002 27.025 21.2375 98-99 22.375 28.000000000000004 28.212500000000002 21.4125 100 20.849999999999998 29.025000000000002 27.85 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.5 20 1.5 21 1.5 22 2.0 23 1.5 24 1.5 25 3.5 26 5.0 27 8.0 28 10.0 29 13.0 30 16.0 31 22.0 32 38.0 33 44.0 34 56.5 35 80.0 36 90.5 37 111.0 38 148.5 39 177.5 40 200.5 41 226.0 42 224.0 43 247.5 44 303.0 45 285.5 46 247.0 47 239.0 48 223.5 49 182.5 50 156.0 51 137.0 52 106.0 53 89.5 54 65.5 55 48.5 56 39.5 57 29.0 58 26.5 59 21.5 60 12.5 61 9.5 62 10.5 63 8.5 64 4.0 65 4.0 66 3.5 67 1.0 68 1.0 69 2.0 70 2.5 71 1.5 72 0.5 73 0.5 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77329974811083 99.02499999999999 2 0.15113350125944583 0.3 3 0.0 0.0 4 0.0 0.0 5 0.05037783375314861 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 19 (97% over 40bp) CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAG 5 0.125 Illumina Multiplexing PCR Primer 2.01 (100% over 30bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTA 5 0.125 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.25 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.325 0.0 0.0 0.0 0.0 34-35 0.325 0.0 0.0 0.0 0.0 36-37 0.325 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.325 0.0 0.0 0.0 0.0 48-49 0.35 0.0 0.0 0.0 0.0 50-51 0.35 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.35 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.35 0.0 0.0 0.0 0.0 60-61 0.375 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4 0.0 0.0 0.0 0.0 66-67 0.4125 0.0 0.0 0.0 0.0 68-69 0.45 0.0 0.0 0.0 0.0 70-71 0.45 0.0 0.0 0.0 0.0 72-73 0.45 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845101 spots for SRR3207981.sra Written 845101 spots for SRR3207981.sra Read 845114 spots for SRR3207981.sra Written 845114 spots for SRR3207981.sra SRR ids: ['SRR3207981.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3kydop00 SRR3207981.sra spots: 16902033 blocks: [[1, 845101], [845102, 1690202], [1690203, 2535303], [2535304, 3380404], [3380405, 4225505], [4225506, 5070606], [5070607, 5915707], [5915708, 6760808], [6760809, 7605909], [7605910, 8451010], [8451011, 9296111], [9296112, 10141212], [10141213, 10986313], [10986314, 11831414], [11831415, 12676515], [12676516, 13521616], [13521617, 14366717], [14366718, 15211818], [15211819, 16056919], [16056920, 16902033]] SRR3207981 file size 4387776 SRR3207981 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207981 SRR3207981_1.fastq Input file: SRR3207981_1.fastq trimmed: SRR3207981-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:19:37 2025 >> started Tue Feb 11 23:19:45 2025 >> done (8.037s) 16902033 reads processed; of these: 2092 ( 0.01%) short reads filtered out after trimming by size control 110294 ( 0.65%) empty reads filtered out after trimming by size control 16789647 (99.34%) reads available; of these: 711249 ( 4.24%) trimmed reads available after processing 16078398 (95.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 339 0.00% 19 2095 0.01% 20 10103 0.06% 21 807 0.00% 22 763 0.00% 23 1113 0.01% 24 1547 0.01% 25 2015 0.01% 26 2453 0.01% 27 2251 0.01% 28 2350 0.01% 29 2558 0.02% 30 2172 0.01% 31 3379 0.02% 32 2738 0.02% 33 3063 0.02% 34 2592 0.02% 35 2569 0.02% 36 3444 0.02% 37 2842 0.02% 38 2953 0.02% 39 3288 0.02% 40 3192 0.02% 41 3456 0.02% 42 3318 0.02% 43 3402 0.02% 44 3593 0.02% 45 3531 0.02% 46 3708 0.02% 47 3846 0.02% 48 4163 0.02% 49 4307 0.03% 50 4149 0.02% 51 4334 0.03% 52 4638 0.03% 53 4782 0.03% 54 4571 0.03% 55 4832 0.03% 56 5154 0.03% 57 5479 0.03% 58 5515 0.03% 59 5771 0.03% 60 5953 0.04% 61 6085 0.04% 62 6004 0.04% 63 5982 0.04% 64 6253 0.04% 65 7553 0.04% 66 6436 0.04% 67 7025 0.04% 68 7098 0.04% 69 6660 0.04% 70 7631 0.05% 71 8344 0.05% 72 8075 0.05% 73 7837 0.05% 74 7768 0.05% 75 7902 0.05% 76 5864 0.03% 77 6406 0.04% 78 7063 0.04% 79 7675 0.05% 80 7930 0.05% 81 8682 0.05% 82 9059 0.05% 83 10122 0.06% 84 10549 0.06% 85 10823 0.06% 86 11699 0.07% 87 12687 0.08% 88 13561 0.08% 89 15226 0.09% 90 16466 0.10% 91 18445 0.11% 92 20982 0.12% 93 23497 0.14% 94 26992 0.16% 95 30977 0.18% 96 36970 0.22% 97 43156 0.26% 98 49466 0.29% 99 51171 0.30% 100 16078398 95.76% 16789647 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=31.69 fanout-score-rank=9 prefix-density=0.28 prefix-fanout=26.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=291.77 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:20:14 Started mapping on | Feb 11 23:20:15 Finished on | Feb 11 23:20:33 Mapping speed, Million of reads per hour | 3357.93 Number of input reads | 16789647 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15794672 Uniquely mapped reads % | 94.07% Average mapped length | 98.96 Number of splices: Total | 4773527 Number of splices: Annotated (sjdb) | 4691005 Number of splices: GT/AG | 4701489 Number of splices: GC/AG | 60009 Number of splices: AT/AC | 4689 Number of splices: Non-canonical | 7340 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371555 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 250743 % of reads mapped to too many loci | 1.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 623420 623420 623420 N_multimapping 371555 371555 371555 N_noFeature 672117 8152345 8208145 N_ambiguous 159990 26620 27317 UnstrandedReadsAssigned:14962565 PositiveStrandReadsAssigned:7615707 NegativeStrandReadsAssigned:7559210 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207981 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207981-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,789,647 reads, 15,492,268 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR3207981.ke.tsv 34699 SRR3207981.se.tsv 87100 total ==> SRR3207981.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 409 20.696 Potri.005G024800.1.v4.1 1035 936 47 4.87596 Potri.004G059700.1.v4.1 961 862 21 2.36565 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 250.277 8.54534 Potri.016G087400.1.v4.1 270 171 564 320.273 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 56 3.24841 Potri.012G127500.1.v4.1 977 878 1952 215.885 ==> SRR3207981.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1546 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 52 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3207981 completed mapping pipeline successfully