Starting /dee2/code/volunteer_pipeline.sh SRR3207982 current disk space = 3052600356864 free memory = 1356031620 SRR3207982 SRAfilesize e6f5e4c77f54039558e1ba4e6bfdbc01 SRR3207982.sra SRR3207982.sra file validated SRR3207982 is single end SRR3207982 is conventional basespace SRR3207982 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207982_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.182 34.0 33.0 34.0 31.0 34.0 2 33.332 34.0 34.0 34.0 31.0 34.0 3 33.3915 34.0 34.0 34.0 31.0 34.0 4 36.62825 37.0 37.0 37.0 35.0 37.0 5 36.55125 37.0 37.0 37.0 35.0 37.0 6 36.41625 37.0 37.0 37.0 35.0 37.0 7 36.4965 37.0 37.0 37.0 35.0 37.0 8 36.40575 37.0 37.0 37.0 35.0 37.0 9 38.22775 39.0 39.0 39.0 37.0 39.0 10-11 38.293625 39.0 39.0 39.0 37.0 39.0 12-13 38.416875000000005 39.0 39.0 39.0 37.0 39.0 14-15 40.130875 41.0 40.0 41.0 38.0 41.0 16-17 39.9495 41.0 40.0 41.0 38.0 41.0 18-19 39.93537499999999 41.0 40.0 41.0 38.0 41.0 20-21 40.04575 41.0 40.0 41.0 38.0 41.0 22-23 39.896375 41.0 40.0 41.0 38.0 41.0 24-25 39.9015 41.0 40.0 41.0 38.0 41.0 26-27 39.923500000000004 41.0 40.0 41.0 38.0 41.0 28-29 39.832125000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.66575 41.0 40.0 41.0 38.0 41.0 32-33 39.556375 41.0 40.0 41.0 37.0 41.0 34-35 39.554375 41.0 40.0 41.0 37.5 41.0 36-37 39.476875 41.0 40.0 41.0 37.0 41.0 38-39 39.46275 41.0 40.0 41.0 37.0 41.0 40-41 39.337875 41.0 40.0 41.0 36.5 41.0 42-43 39.274875 41.0 39.0 41.0 36.5 41.0 44-45 39.283875 41.0 39.0 41.0 36.5 41.0 46-47 39.23025 41.0 39.0 41.0 36.5 41.0 48-49 39.25725 41.0 39.5 41.0 36.5 41.0 50-51 39.3185 41.0 39.5 41.0 36.0 41.0 52-53 39.358 41.0 39.5 41.0 36.0 41.0 54-55 39.278625 41.0 39.0 41.0 36.0 41.0 56-57 38.730125 41.0 39.0 41.0 35.0 41.0 58-59 38.8525 41.0 39.0 41.0 35.0 41.0 60-61 38.727125 40.5 38.0 41.0 35.0 41.0 62-63 38.582625 40.0 37.5 41.0 35.0 41.0 64-65 38.270125 39.5 37.0 41.0 35.0 41.0 66-67 37.90225 39.0 37.0 41.0 34.5 41.0 68-69 37.541 39.0 36.0 41.0 34.5 41.0 70-71 36.987624999999994 37.5 35.5 40.0 34.0 41.0 72-73 36.282875000000004 37.0 35.0 39.0 33.5 41.0 74-75 35.893375000000006 37.0 35.0 39.0 33.0 40.5 76-77 34.905249999999995 36.0 34.5 37.0 31.5 39.0 78-79 35.065875000000005 36.0 35.0 37.0 32.5 39.0 80-81 34.90025 35.0 35.0 37.0 33.0 39.0 82-83 34.574375 35.0 35.0 36.0 33.0 37.0 84-85 34.336124999999996 35.0 35.0 36.0 33.0 37.0 86-87 34.103624999999994 35.0 35.0 36.0 32.5 36.5 88-89 33.89975 35.0 35.0 35.0 32.0 36.0 90-91 33.724875 35.0 35.0 35.0 32.0 36.0 92-93 33.65625 35.0 35.0 35.0 32.0 36.0 94-95 33.54900000000001 35.0 35.0 35.0 32.0 36.0 96-97 33.516000000000005 35.0 35.0 35.0 32.0 35.5 98-99 33.3835 35.0 35.0 35.0 32.0 35.0 100 33.2155 35.0 34.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 4.0 12 3.0 13 0.0 14 2.0 15 2.0 16 5.0 17 2.0 18 2.0 19 2.0 20 1.0 21 6.0 22 3.0 23 5.0 24 6.0 25 9.0 26 6.0 27 24.0 28 24.0 29 18.0 30 27.0 31 36.0 32 41.0 33 52.0 34 79.0 35 128.0 36 249.0 37 725.0 38 1927.0 39 606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.05 15.925 14.649999999999999 46.375 2 19.3 23.325000000000003 39.2 18.175 3 20.474999999999998 27.075 28.499999999999996 23.95 4 23.025000000000002 33.6 21.55 21.825 5 24.256064016004 35.75893973493373 22.355588897224308 17.62940735183796 6 18.55 37.875 24.3 19.275000000000002 7 16.375 19.15 43.2 21.275 8 19.225 22.975 30.925000000000004 26.875 9 20.150000000000002 23.125 32.0 24.725 10-11 22.8375 33.525 22.537499999999998 21.099999999999998 12-13 20.65 25.45 29.9875 23.9125 14-15 20.5375 27.462500000000002 29.7375 22.2625 16-17 22.0625 27.6 27.462500000000002 22.875 18-19 21.087500000000002 28.849999999999998 28.3125 21.75 20-21 21.6 28.9125 27.787499999999998 21.7 22-23 21.1125 28.8875 28.249999999999996 21.75 24-25 21.042760690172543 28.81970492623156 27.881970492623154 22.255563890972745 26-27 21.512500000000003 28.725 27.712500000000002 22.05 28-29 21.441080810607957 28.984238178633976 27.52064048036027 22.0540405303978 30-31 21.832749123685527 27.679018527791687 27.71657486229344 22.771657486229344 32-33 21.975 28.712500000000002 26.4625 22.85 34-35 22.0125 28.262500000000003 27.575 22.15 36-37 21.3625 28.549999999999997 28.3125 21.775 38-39 22.175 28.449999999999996 27.55 21.825 40-41 21.6 28.0625 28.537499999999998 21.8 42-43 21.1125 28.012500000000003 28.5875 22.287499999999998 44-45 22.6125 27.5875 27.925 21.875 46-47 21.0625 28.275 28.8875 21.775 48-49 22.225 28.050000000000004 28.262500000000003 21.462500000000002 50-51 21.875 28.6875 27.4125 22.025 52-53 21.125 28.475 28.025 22.375 54-55 21.4375 27.950000000000003 27.8625 22.75 56-57 21.45 28.025 28.6125 21.912499999999998 58-59 21.45 28.449999999999996 28.3125 21.7875 60-61 21.1375 27.650000000000002 29.275000000000002 21.9375 62-63 21.475 27.05 28.875 22.6 64-65 20.7 28.9375 28.299999999999997 22.0625 66-67 21.3875 28.9125 27.925 21.775 68-69 21.65 28.212500000000002 27.8375 22.3 70-71 21.75 28.262500000000003 27.6875 22.3 72-73 21.7875 27.8375 27.750000000000004 22.625 74-75 21.5625 28.975 27.8625 21.6 76-77 22.112499999999997 28.15 27.287499999999998 22.45 78-79 21.1125 29.262500000000003 27.787499999999998 21.837500000000002 80-81 22.1875 27.950000000000003 28.0875 21.775 82-83 21.425 28.6125 28.0625 21.9 84-85 21.912499999999998 28.5625 27.8125 21.712500000000002 86-87 21.637500000000003 27.875 28.075 22.412499999999998 88-89 21.425 28.849999999999998 27.8375 21.8875 90-91 22.325 28.4125 28.1 21.1625 92-93 22.35 28.15 27.425 22.075 94-95 22.400000000000002 27.8375 28.237499999999997 21.525 96-97 22.412499999999998 28.549999999999997 27.8375 21.2 98-99 21.4 28.775000000000002 28.4 21.425 100 22.15 28.975 27.075 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 5.0 27 4.0 28 8.0 29 12.0 30 16.0 31 31.5 32 40.5 33 42.5 34 60.5 35 80.5 36 98.0 37 116.0 38 137.5 39 172.5 40 201.0 41 225.5 42 235.0 43 259.5 44 285.0 45 282.0 46 271.0 47 251.5 48 243.5 49 206.0 50 146.5 51 123.5 52 107.5 53 85.0 54 70.0 55 48.0 56 35.0 57 29.0 58 19.0 59 10.5 60 6.0 61 5.5 62 6.5 63 6.0 64 3.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.075 30-31 0.15 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74823766364553 99.05000000000001 2 0.2014098690835851 0.4 3 0.0 0.0 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 17 0.42500000000000004 TruSeq Adapter, Index 2 (100% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG 5 0.125 TruSeq Adapter, Index 2 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAATG 15 6.4061093E-4 94.0 3 AAAATGG 20 0.0020083564 70.5 4 >>END_MODULE Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755914 spots for SRR3207982.sra Written 755914 spots for SRR3207982.sra Read 755924 spots for SRR3207982.sra Written 755924 spots for SRR3207982.sra SRR ids: ['SRR3207982.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_38gm1gq3 SRR3207982.sra spots: 15118290 blocks: [[1, 755914], [755915, 1511828], [1511829, 2267742], [2267743, 3023656], [3023657, 3779570], [3779571, 4535484], [4535485, 5291398], [5291399, 6047312], [6047313, 6803226], [6803227, 7559140], [7559141, 8315054], [8315055, 9070968], [9070969, 9826882], [9826883, 10582796], [10582797, 11338710], [11338711, 12094624], [12094625, 12850538], [12850539, 13606452], [13606453, 14362366], [14362367, 15118290]] SRR3207982 file size 3923666 SRR3207982 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207982 SRR3207982_1.fastq Input file: SRR3207982_1.fastq trimmed: SRR3207982-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:42:54 2025 >> started Tue Feb 11 22:43:02 2025 >> done (7.576s) 15118290 reads processed; of these: 1622 ( 0.01%) short reads filtered out after trimming by size control 90087 ( 0.60%) empty reads filtered out after trimming by size control 15026581 (99.39%) reads available; of these: 576400 ( 3.84%) trimmed reads available after processing 14450181 (96.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 221 0.00% 19 304 0.00% 20 370 0.00% 21 444 0.00% 22 627 0.00% 23 877 0.01% 24 1149 0.01% 25 1546 0.01% 26 1538 0.01% 27 1570 0.01% 28 1540 0.01% 29 1618 0.01% 30 1627 0.01% 31 1644 0.01% 32 1731 0.01% 33 1723 0.01% 34 1929 0.01% 35 2026 0.01% 36 2064 0.01% 37 2273 0.02% 38 2224 0.01% 39 2239 0.01% 40 2320 0.02% 41 2432 0.02% 42 2526 0.02% 43 2636 0.02% 44 2768 0.02% 45 2710 0.02% 46 2827 0.02% 47 2948 0.02% 48 2908 0.02% 49 3041 0.02% 50 3087 0.02% 51 3294 0.02% 52 3349 0.02% 53 3435 0.02% 54 3604 0.02% 55 3647 0.02% 56 3830 0.03% 57 4016 0.03% 58 4178 0.03% 59 4201 0.03% 60 4511 0.03% 61 4554 0.03% 62 4598 0.03% 63 4730 0.03% 64 4921 0.03% 65 5150 0.03% 66 5361 0.04% 67 5366 0.04% 68 6193 0.04% 69 6096 0.04% 70 5767 0.04% 71 5757 0.04% 72 5770 0.04% 73 6179 0.04% 74 6349 0.04% 75 6260 0.04% 76 4570 0.03% 77 5125 0.03% 78 5783 0.04% 79 6363 0.04% 80 6850 0.05% 81 7222 0.05% 82 7564 0.05% 83 8418 0.06% 84 8619 0.06% 85 9201 0.06% 86 9640 0.06% 87 10382 0.07% 88 11283 0.08% 89 12347 0.08% 90 13243 0.09% 91 14994 0.10% 92 16860 0.11% 93 19257 0.13% 94 22753 0.15% 95 26140 0.17% 96 30687 0.20% 97 37180 0.25% 98 43232 0.29% 99 56084 0.37% 100 14450181 96.16% 15026581 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=43.47 fanout-score-rank=8 prefix-density=0.43 prefix-fanout=31.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=262.33 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:43:21 Started mapping on | Feb 11 22:43:21 Finished on | Feb 11 22:43:36 Mapping speed, Million of reads per hour | 3606.38 Number of input reads | 15026581 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14442022 Uniquely mapped reads % | 96.11% Average mapped length | 98.99 Number of splices: Total | 4470789 Number of splices: Annotated (sjdb) | 4395022 Number of splices: GT/AG | 4404022 Number of splices: GC/AG | 55412 Number of splices: AT/AC | 4356 Number of splices: Non-canonical | 6999 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314670 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 64637 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 269889 269889 269889 N_multimapping 314670 314670 314670 N_noFeature 587505 7431545 7504222 N_ambiguous 140903 23501 23873 UnstrandedReadsAssigned:13713614 PositiveStrandReadsAssigned:6986976 NegativeStrandReadsAssigned:6913927 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207982 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207982-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,026,581 reads, 14,031,498 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR3207982.ke.tsv 34699 SRR3207982.se.tsv 87100 total ==> SRR3207982.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 385 21.6045 Potri.005G024800.1.v4.1 1035 936 56 6.44275 Potri.004G059700.1.v4.1 961 862 22 2.74836 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 239.3 9.06093 Potri.016G087400.1.v4.1 270 171 470 295.979 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 32 2.05851 Potri.012G127500.1.v4.1 977 878 2145 263.082 ==> SRR3207982.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1411 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 36 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207982 completed mapping pipeline successfully