Starting /dee2/code/volunteer_pipeline.sh SRR3207983 current disk space = 3052437790720 free memory = 1486270856 SRR3207983 SRAfilesize 322c06c7beb9c363f148cdfdd4d6c07d SRR3207983.sra SRR3207983.sra file validated SRR3207983 is single end SRR3207983 is conventional basespace SRR3207983 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207983_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1325 34.0 33.0 34.0 31.0 34.0 2 33.3025 34.0 34.0 34.0 31.0 34.0 3 33.3175 34.0 34.0 34.0 31.0 34.0 4 36.5985 37.0 37.0 37.0 35.0 37.0 5 36.51525 37.0 37.0 37.0 35.0 37.0 6 36.5045 37.0 37.0 37.0 35.0 37.0 7 36.531 37.0 37.0 37.0 35.0 37.0 8 36.52575 37.0 37.0 37.0 35.0 37.0 9 38.3705 39.0 39.0 39.0 37.0 39.0 10-11 38.408500000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.374875 39.0 39.0 39.0 37.0 39.0 14-15 39.914625 41.0 40.0 41.0 38.0 41.0 16-17 39.988375000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.97 41.0 40.0 41.0 38.0 41.0 20-21 39.930125000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.912 41.0 40.0 41.0 38.0 41.0 24-25 39.8635 41.0 40.0 41.0 38.0 41.0 26-27 39.75175 41.0 40.0 41.0 38.0 41.0 28-29 39.660250000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.48825 41.0 40.0 41.0 37.0 41.0 32-33 39.475125 41.0 40.0 41.0 37.0 41.0 34-35 39.191374999999994 41.0 39.5 41.0 36.0 41.0 36-37 39.233125 41.0 39.0 41.0 36.5 41.0 38-39 39.125375 41.0 39.0 41.0 36.0 41.0 40-41 39.090875 40.5 39.0 41.0 36.0 41.0 42-43 38.968125 40.5 39.0 41.0 35.0 41.0 44-45 38.778375 40.0 39.0 41.0 35.0 41.0 46-47 38.892624999999995 40.0 39.0 41.0 35.0 41.0 48-49 38.760374999999996 40.0 39.0 41.0 35.0 41.0 50-51 38.954875 41.0 39.0 41.0 35.0 41.0 52-53 38.949 41.0 39.0 41.0 35.0 41.0 54-55 38.68275 41.0 39.0 41.0 35.0 41.0 56-57 38.60575 41.0 38.0 41.0 35.0 41.0 58-59 38.383375 40.0 38.0 41.0 34.5 41.0 60-61 38.286 40.0 37.5 41.0 35.0 41.0 62-63 37.93825 40.0 37.0 41.0 34.0 41.0 64-65 37.594125 39.5 36.5 41.0 34.0 41.0 66-67 37.1555 39.0 36.0 41.0 33.5 41.0 68-69 36.799375 39.0 35.0 40.5 33.0 41.0 70-71 36.350375 37.0 35.0 39.5 32.5 41.0 72-73 35.801125 37.0 35.0 39.0 32.0 41.0 74-75 35.440124999999995 36.5 35.0 39.0 32.0 40.5 76-77 34.33075 35.0 34.0 37.0 30.0 39.0 78-79 34.447 35.0 34.5 37.0 31.0 39.0 80-81 34.242000000000004 35.0 35.0 37.0 31.0 39.0 82-83 33.877875 35.0 34.5 36.0 31.0 37.0 84-85 33.544 35.0 34.0 36.0 30.0 37.0 86-87 33.421875 35.0 34.0 35.5 31.0 36.5 88-89 33.26925 35.0 34.0 35.0 31.0 36.0 90-91 33.010625 35.0 34.0 35.0 30.0 36.0 92-93 32.822374999999994 35.0 34.0 35.0 29.5 36.0 94-95 32.651125 35.0 34.0 35.0 29.0 35.5 96-97 32.574875 35.0 34.0 35.0 29.0 35.0 98-99 32.44775 35.0 34.0 35.0 29.0 35.0 100 32.36375 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 6.0 13 8.0 14 3.0 15 2.0 16 7.0 17 3.0 18 3.0 19 10.0 20 7.0 21 4.0 22 15.0 23 8.0 24 11.0 25 12.0 26 11.0 27 17.0 28 25.0 29 26.0 30 27.0 31 33.0 32 62.0 33 72.0 34 104.0 35 162.0 36 290.0 37 783.0 38 1749.0 39 532.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.25 16.075 15.925 43.75 2 20.150000000000002 23.825 36.125 19.900000000000002 3 20.175 28.000000000000004 28.249999999999996 23.575 4 24.099999999999998 31.65 21.125 23.125 5 23.655913978494624 35.13378344586147 23.055763940985248 18.154538634658664 6 17.875 38.625 24.725 18.775 7 17.549999999999997 18.325 42.425000000000004 21.7 8 19.0 24.3 29.25 27.450000000000003 9 21.125 22.875 31.974999999999998 24.025 10-11 22.125 32.875 23.45 21.55 12-13 20.4125 26.724999999999998 29.2875 23.575 14-15 21.55 28.025 28.1125 22.3125 16-17 21.637500000000003 28.025 27.8875 22.45 18-19 21.425 28.6875 27.224999999999998 22.662499999999998 20-21 21.9375 28.5875 27.375 22.1 22-23 21.025 29.875 26.6125 22.4875 24-25 21.2 29.262500000000003 27.8875 21.65 26-27 21.625 29.15 27.1125 22.112499999999997 28-29 21.819091705242087 27.974477667959462 27.911922932565997 22.294507694232454 30-31 21.364205256570713 29.524405506883607 27.55944931163955 21.551939924906133 32-33 21.375 28.9875 27.6625 21.975 34-35 21.25 29.312500000000004 27.500000000000004 21.9375 36-37 21.712500000000002 28.675 28.1125 21.5 38-39 21.525 29.1125 26.6125 22.75 40-41 21.7875 28.6375 27.037499999999998 22.537499999999998 42-43 21.25 29.15 27.9125 21.6875 44-45 21.375 28.5625 27.85 22.2125 46-47 22.5125 28.375 27.037499999999998 22.075 48-49 22.037499999999998 28.825 27.925 21.212500000000002 50-51 21.512500000000003 27.55 28.999999999999996 21.9375 52-53 22.3125 28.9 26.724999999999998 22.0625 54-55 21.85 28.3375 28.15 21.6625 56-57 21.0625 28.775000000000002 27.950000000000003 22.2125 58-59 22.175 28.675 27.675 21.475 60-61 21.125 28.799999999999997 28.499999999999996 21.575 62-63 22.287499999999998 28.15 28.025 21.5375 64-65 21.525 29.012500000000003 27.150000000000002 22.3125 66-67 21.6625 28.799999999999997 27.787499999999998 21.75 68-69 21.2875 28.749999999999996 27.474999999999998 22.4875 70-71 21.9625 28.525 27.700000000000003 21.8125 72-73 22.0125 27.200000000000003 29.049999999999997 21.7375 74-75 22.3875 28.999999999999996 27.237499999999997 21.375 76-77 22.4875 28.1 27.8125 21.6 78-79 21.512500000000003 28.549999999999997 28.3375 21.6 80-81 21.762500000000003 28.1625 28.175 21.9 82-83 21.7 28.025 27.8375 22.4375 84-85 22.5625 26.474999999999998 29.2375 21.725 86-87 21.5625 28.3125 28.749999999999996 21.375 88-89 22.2 27.900000000000002 28.075 21.825 90-91 22.475 27.737499999999997 28.325 21.462500000000002 92-93 22.375 28.249999999999996 28.025 21.349999999999998 94-95 22.35 28.575 27.9375 21.1375 96-97 21.762500000000003 28.249999999999996 27.6875 22.3 98-99 22.575 28.3625 27.8625 21.2 100 22.7 28.275 28.325 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 2.0 23 2.5 24 2.5 25 5.0 26 5.0 27 6.5 28 13.0 29 18.5 30 22.5 31 28.0 32 36.0 33 46.0 34 69.0 35 83.5 36 94.5 37 108.5 38 135.5 39 168.5 40 189.5 41 231.0 42 258.5 43 257.0 44 260.0 45 267.0 46 251.5 47 235.5 48 235.5 49 200.0 50 154.5 51 138.0 52 106.5 53 71.0 54 62.5 55 52.0 56 38.5 57 32.0 58 26.0 59 19.0 60 13.0 61 10.0 62 7.0 63 8.5 64 5.5 65 2.0 66 3.0 67 2.0 68 1.0 69 1.0 70 1.5 71 1.0 72 1.5 73 1.5 74 1.5 75 1.5 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.08750000000000001 30-31 0.125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.0625 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1125 0.0 0.0 0.0 0.0 32-33 0.16249999999999998 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.1875 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790902 spots for SRR3207983.sra Written 790902 spots for SRR3207983.sra Read 790919 spots for SRR3207983.sra Written 790919 spots for SRR3207983.sra SRR ids: ['SRR3207983.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ehze9s5l SRR3207983.sra spots: 15818057 blocks: [[1, 790902], [790903, 1581804], [1581805, 2372706], [2372707, 3163608], [3163609, 3954510], [3954511, 4745412], [4745413, 5536314], [5536315, 6327216], [6327217, 7118118], [7118119, 7909020], [7909021, 8699922], [8699923, 9490824], [9490825, 10281726], [10281727, 11072628], [11072629, 11863530], [11863531, 12654432], [12654433, 13445334], [13445335, 14236236], [14236237, 15027138], [15027139, 15818057]] SRR3207983 file size 4105804 SRR3207983 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207983 SRR3207983_1.fastq Input file: SRR3207983_1.fastq trimmed: SRR3207983-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:58:07 2025 >> started Tue Feb 11 22:58:14 2025 >> done (7.033s) 15818057 reads processed; of these: 2705 ( 0.02%) short reads filtered out after trimming by size control 19233 ( 0.12%) empty reads filtered out after trimming by size control 15796119 (99.86%) reads available; of these: 738341 ( 4.67%) trimmed reads available after processing 15057778 (95.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 352 0.00% 19 459 0.00% 20 528 0.00% 21 750 0.00% 22 1047 0.01% 23 1391 0.01% 24 1899 0.01% 25 2416 0.02% 26 3026 0.02% 27 2788 0.02% 28 2651 0.02% 29 2595 0.02% 30 2400 0.02% 31 2524 0.02% 32 2712 0.02% 33 2743 0.02% 34 2979 0.02% 35 2812 0.02% 36 2969 0.02% 37 3068 0.02% 38 3198 0.02% 39 3178 0.02% 40 3363 0.02% 41 3500 0.02% 42 3558 0.02% 43 3839 0.02% 44 3762 0.02% 45 3956 0.03% 46 4075 0.03% 47 4186 0.03% 48 4197 0.03% 49 4340 0.03% 50 4139 0.03% 51 4299 0.03% 52 4415 0.03% 53 4639 0.03% 54 4756 0.03% 55 4852 0.03% 56 5079 0.03% 57 5170 0.03% 58 5304 0.03% 59 5282 0.03% 60 5485 0.03% 61 5735 0.04% 62 5873 0.04% 63 5941 0.04% 64 5963 0.04% 65 6234 0.04% 66 6642 0.04% 67 6851 0.04% 68 7195 0.05% 69 7007 0.04% 70 7275 0.05% 71 7454 0.05% 72 7822 0.05% 73 7963 0.05% 74 8420 0.05% 75 8535 0.05% 76 5931 0.04% 77 6860 0.04% 78 7656 0.05% 79 8179 0.05% 80 8756 0.06% 81 9482 0.06% 82 10099 0.06% 83 10641 0.07% 84 11103 0.07% 85 11916 0.08% 86 12760 0.08% 87 13251 0.08% 88 14676 0.09% 89 16188 0.10% 90 17880 0.11% 91 19945 0.13% 92 21966 0.14% 93 24750 0.16% 94 29120 0.18% 95 34419 0.22% 96 40677 0.26% 97 47974 0.30% 98 53007 0.34% 99 55514 0.35% 100 15057778 95.33% 15796119 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.91 fanout-score-rank=23 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=329.60 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:58:33 Started mapping on | Feb 11 22:58:33 Finished on | Feb 11 22:59:00 Mapping speed, Million of reads per hour | 2106.15 Number of input reads | 15796119 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14470013 Uniquely mapped reads % | 91.60% Average mapped length | 98.88 Number of splices: Total | 4258533 Number of splices: Annotated (sjdb) | 4182981 Number of splices: GT/AG | 4193099 Number of splices: GC/AG | 54183 Number of splices: AT/AC | 4324 Number of splices: Non-canonical | 6927 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347943 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 114728 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 978163 978163 978163 N_multimapping 347943 347943 347943 N_noFeature 651552 7478608 7542571 N_ambiguous 150319 24857 25300 UnstrandedReadsAssigned:13668142 PositiveStrandReadsAssigned:6966548 NegativeStrandReadsAssigned:6902142 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207983 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207983-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,796,119 reads, 14,056,195 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR3207983.ke.tsv 34699 SRR3207983.se.tsv 87100 total ==> SRR3207983.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 480 25.7081 Potri.005G024800.1.v4.1 1035 936 100 10.9807 Potri.004G059700.1.v4.1 961 862 13 1.55003 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 219.227 7.92262 Potri.016G087400.1.v4.1 270 171 477 286.699 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 59 3.62243 Potri.012G127500.1.v4.1 977 878 3046 356.565 ==> SRR3207983.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1520 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207983 completed mapping pipeline successfully