Starting /dee2/code/volunteer_pipeline.sh SRR3207984 current disk space = 3052396707840 free memory = 1571740136 SRR3207984 SRAfilesize e97f46b4094c3041b8837312df54d243 SRR3207984.sra SRR3207984.sra file validated SRR3207984 is single end SRR3207984 is conventional basespace SRR3207984 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207984_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1665 34.0 33.0 34.0 31.0 34.0 2 33.305 34.0 34.0 34.0 31.0 34.0 3 33.3345 34.0 34.0 34.0 31.0 34.0 4 36.608 37.0 37.0 37.0 35.0 37.0 5 36.55375 37.0 37.0 37.0 35.0 37.0 6 36.55325 37.0 37.0 37.0 35.0 37.0 7 36.5455 37.0 37.0 37.0 35.0 37.0 8 36.553 37.0 37.0 37.0 35.0 37.0 9 38.3675 39.0 39.0 39.0 37.0 39.0 10-11 38.449124999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.400875 39.0 39.0 39.0 37.0 39.0 14-15 39.936875 41.0 40.0 41.0 38.0 41.0 16-17 39.99425 41.0 40.0 41.0 38.0 41.0 18-19 40.052875 41.0 40.0 41.0 38.0 41.0 20-21 40.045874999999995 41.0 40.0 41.0 38.0 41.0 22-23 39.996624999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.9015 41.0 40.0 41.0 38.0 41.0 26-27 39.842375 41.0 40.0 41.0 38.0 41.0 28-29 39.733875 41.0 40.0 41.0 38.0 41.0 30-31 39.594750000000005 41.0 40.0 41.0 37.5 41.0 32-33 39.58375 41.0 40.0 41.0 37.5 41.0 34-35 39.306875000000005 41.0 39.5 41.0 36.5 41.0 36-37 39.37325 41.0 39.5 41.0 37.0 41.0 38-39 39.253625 41.0 39.0 41.0 36.5 41.0 40-41 39.168499999999995 40.5 39.0 41.0 36.0 41.0 42-43 39.053749999999994 40.5 39.0 41.0 36.0 41.0 44-45 38.963499999999996 40.0 39.0 41.0 35.5 41.0 46-47 38.973 40.5 39.0 41.0 35.0 41.0 48-49 38.915375 40.0 39.0 41.0 35.0 41.0 50-51 39.053250000000006 41.0 39.0 41.0 36.0 41.0 52-53 39.11425 41.0 39.0 41.0 36.0 41.0 54-55 38.928124999999994 41.0 39.0 41.0 35.0 41.0 56-57 38.783874999999995 41.0 39.0 41.0 35.0 41.0 58-59 38.538125 40.0 38.0 41.0 35.0 41.0 60-61 38.50675 40.0 37.5 41.0 35.0 41.0 62-63 38.144 40.0 37.0 41.0 34.0 41.0 64-65 37.8195 39.5 36.5 41.0 34.0 41.0 66-67 37.42475 39.0 36.0 41.0 34.0 41.0 68-69 37.0385 39.0 35.5 40.5 33.5 41.0 70-71 36.618375 37.5 35.0 40.0 33.0 41.0 72-73 36.035375 37.0 35.0 39.0 32.5 41.0 74-75 35.6175 36.5 35.0 39.0 32.0 40.5 76-77 34.488625 35.5 34.0 37.0 30.0 39.0 78-79 34.691375 35.5 35.0 37.0 31.0 39.0 80-81 34.425 35.0 35.0 37.0 31.5 38.5 82-83 34.020250000000004 35.0 34.5 36.0 31.0 37.0 84-85 33.738125 35.0 34.0 36.0 31.0 37.0 86-87 33.574875000000006 35.0 34.0 35.5 31.0 36.5 88-89 33.413 35.0 34.0 35.0 31.0 36.0 90-91 33.180875 35.0 34.0 35.0 31.0 36.0 92-93 32.989000000000004 35.0 34.0 35.0 30.0 36.0 94-95 32.853 35.0 34.0 35.0 30.0 35.5 96-97 32.709 35.0 34.0 35.0 30.0 35.0 98-99 32.549375 35.0 34.0 35.0 29.0 35.0 100 32.49475 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 3.0 12 2.0 13 6.0 14 2.0 15 0.0 16 4.0 17 4.0 18 3.0 19 7.0 20 4.0 21 7.0 22 3.0 23 8.0 24 14.0 25 11.0 26 21.0 27 17.0 28 19.0 29 18.0 30 27.0 31 39.0 32 52.0 33 83.0 34 103.0 35 148.0 36 322.0 37 738.0 38 1810.0 39 521.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.7 15.75 13.825000000000001 46.725 2 19.7 24.85 36.975 18.475 3 22.15 26.174999999999997 27.375 24.3 4 22.95 33.85 21.3 21.9 5 23.986993496748372 35.36768384192096 22.18609304652326 18.459229614807406 6 18.7 36.75 24.45 20.1 7 16.0 18.625 44.175 21.2 8 18.6 22.575 31.324999999999996 27.500000000000004 9 19.950000000000003 23.35 32.425 24.275 10-11 22.85 33.3625 22.075 21.712500000000002 12-13 19.650000000000002 27.0 29.45 23.9 14-15 20.875 28.199999999999996 28.512500000000003 22.412499999999998 16-17 21.725 27.875 27.8875 22.5125 18-19 21.637500000000003 28.5875 27.150000000000002 22.625 20-21 21.725 28.15 27.3125 22.8125 22-23 21.3125 29.525000000000002 27.875 21.2875 24-25 21.90273784223028 28.42855356919615 27.753469183647955 21.915239404925615 26-27 21.0125 28.462500000000002 28.537499999999998 21.987499999999997 28-29 21.288305190744214 27.892432770481552 27.74233896185116 23.076923076923077 30-31 21.361531723188588 27.78125391064948 28.03153547741209 22.82567888874984 32-33 21.875 28.425 27.187499999999996 22.5125 34-35 21.875 29.4875 26.825 21.8125 36-37 21.337500000000002 28.037499999999998 28.125 22.5 38-39 22.425 28.4375 26.387500000000003 22.75 40-41 21.8875 28.9875 27.825 21.3 42-43 21.6625 27.975 28.5875 21.775 44-45 21.9375 27.625 28.125 22.3125 46-47 21.4375 27.375 28.325 22.8625 48-49 22.0625 27.700000000000003 27.287499999999998 22.95 50-51 21.8125 27.875 27.487499999999997 22.825 52-53 21.65 28.525 27.6875 22.1375 54-55 21.95 28.4375 27.437499999999996 22.175 56-57 21.45 28.5875 27.737499999999997 22.225 58-59 21.85 28.287499999999998 27.825 22.037499999999998 60-61 22.0625 26.974999999999998 28.725 22.237499999999997 62-63 21.975 28.875 27.712500000000002 21.4375 64-65 22.650000000000002 27.900000000000002 27.875 21.575 66-67 21.6125 28.537499999999998 28.0625 21.7875 68-69 22.175 28.0875 27.9375 21.8 70-71 22.475 28.1375 27.8125 21.575 72-73 21.175 28.95 27.1375 22.7375 74-75 21.15 28.000000000000004 27.925 22.925 76-77 20.7875 28.4 28.449999999999996 22.3625 78-79 22.8375 27.625 27.712500000000002 21.825 80-81 22.3 28.725 27.725 21.25 82-83 21.95 28.775000000000002 28.1 21.175 84-85 20.75 28.3875 28.537499999999998 22.325 86-87 21.9375 27.875 27.875 22.3125 88-89 21.575 28.575 27.450000000000003 22.400000000000002 90-91 21.712500000000002 28.262500000000003 28.225 21.8 92-93 21.6875 28.025 28.000000000000004 22.287499999999998 94-95 21.85 27.5125 28.475 22.162499999999998 96-97 22.35 27.925 27.437499999999996 22.287499999999998 98-99 22.275 27.787499999999998 27.737499999999997 22.2 100 22.875 27.150000000000002 27.975 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 2.0 24 1.5 25 1.5 26 2.5 27 6.5 28 11.0 29 15.0 30 18.5 31 24.5 32 34.0 33 41.0 34 52.5 35 61.5 36 90.5 37 122.0 38 139.0 39 165.5 40 182.5 41 210.0 42 251.5 43 264.5 44 271.0 45 281.5 46 283.5 47 273.5 48 228.5 49 180.0 50 152.5 51 130.5 52 117.5 53 96.0 54 69.5 55 51.0 56 36.5 57 28.5 58 19.0 59 14.0 60 10.5 61 11.5 62 12.0 63 7.0 64 4.0 65 3.5 66 2.0 67 0.5 68 1.0 69 2.0 70 2.0 71 2.0 72 1.0 73 1.0 74 1.0 75 0.5 76 1.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0625 30-31 0.11249999999999999 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra Read 579279 spots for SRR3207984.sra Written 579279 spots for SRR3207984.sra Read 579267 spots for SRR3207984.sra Written 579267 spots for SRR3207984.sra SRR ids: ['SRR3207984.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4_z52i7h SRR3207984.sra spots: 11585352 blocks: [[1, 579267], [579268, 1158534], [1158535, 1737801], [1737802, 2317068], [2317069, 2896335], [2896336, 3475602], [3475603, 4054869], [4054870, 4634136], [4634137, 5213403], [5213404, 5792670], [5792671, 6371937], [6371938, 6951204], [6951205, 7530471], [7530472, 8109738], [8109739, 8689005], [8689006, 9268272], [9268273, 9847539], [9847540, 10426806], [10426807, 11006073], [11006074, 11585352]] SRR3207984 file size 3004240 SRR3207984 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207984 SRR3207984_1.fastq Input file: SRR3207984_1.fastq trimmed: SRR3207984-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:24:54 2025 >> started Tue Feb 11 23:24:59 2025 >> done (5.774s) 11585352 reads processed; of these: 2095 ( 0.02%) short reads filtered out after trimming by size control 11267 ( 0.10%) empty reads filtered out after trimming by size control 11571990 (99.88%) reads available; of these: 522927 ( 4.52%) trimmed reads available after processing 11049063 (95.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 260 0.00% 19 335 0.00% 20 416 0.00% 21 474 0.00% 22 708 0.01% 23 976 0.01% 24 1223 0.01% 25 1707 0.01% 26 1988 0.02% 27 1954 0.02% 28 1778 0.02% 29 1755 0.02% 30 1724 0.01% 31 1674 0.01% 32 1853 0.02% 33 1859 0.02% 34 1934 0.02% 35 1993 0.02% 36 2166 0.02% 37 2097 0.02% 38 2281 0.02% 39 2242 0.02% 40 2325 0.02% 41 2466 0.02% 42 2517 0.02% 43 2620 0.02% 44 2664 0.02% 45 2623 0.02% 46 2841 0.02% 47 2873 0.02% 48 2937 0.03% 49 2956 0.03% 50 2774 0.02% 51 3001 0.03% 52 3202 0.03% 53 3199 0.03% 54 3316 0.03% 55 3405 0.03% 56 3445 0.03% 57 3592 0.03% 58 3588 0.03% 59 3912 0.03% 60 3877 0.03% 61 4004 0.03% 62 4138 0.04% 63 4262 0.04% 64 4223 0.04% 65 4276 0.04% 66 4532 0.04% 67 4681 0.04% 68 4865 0.04% 69 4915 0.04% 70 4980 0.04% 71 5127 0.04% 72 5365 0.05% 73 5729 0.05% 74 5960 0.05% 75 5941 0.05% 76 4328 0.04% 77 4842 0.04% 78 5421 0.05% 79 5868 0.05% 80 6255 0.05% 81 6677 0.06% 82 7169 0.06% 83 7814 0.07% 84 8000 0.07% 85 8628 0.07% 86 9103 0.08% 87 9441 0.08% 88 10308 0.09% 89 11338 0.10% 90 12569 0.11% 91 14094 0.12% 92 15991 0.14% 93 17576 0.15% 94 20874 0.18% 95 24490 0.21% 96 29063 0.25% 97 34173 0.30% 98 38257 0.33% 99 40120 0.35% 100 11049063 95.48% 11571990 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=25 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=298.29 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=27.7 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:25:15 Started mapping on | Feb 11 23:25:15 Finished on | Feb 11 23:25:30 Mapping speed, Million of reads per hour | 2777.28 Number of input reads | 11571990 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11044979 Uniquely mapped reads % | 95.45% Average mapped length | 98.91 Number of splices: Total | 3268091 Number of splices: Annotated (sjdb) | 3212865 Number of splices: GT/AG | 3219309 Number of splices: GC/AG | 40461 Number of splices: AT/AC | 3185 Number of splices: Non-canonical | 5136 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256971 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 64000 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 270040 270040 270040 N_multimapping 256971 256971 256971 N_noFeature 468549 5694331 5742840 N_ambiguous 114548 19166 19175 UnstrandedReadsAssigned:10461882 PositiveStrandReadsAssigned:5331482 NegativeStrandReadsAssigned:5282964 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207984 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207984-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,571,990 reads, 10,734,620 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR3207984.ke.tsv 34699 SRR3207984.se.tsv 87100 total ==> SRR3207984.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 330 23.4224 Potri.005G024800.1.v4.1 1035 936 86 12.5145 Potri.004G059700.1.v4.1 961 862 13 2.05413 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 141.227 6.76364 Potri.016G087400.1.v4.1 270 171 352.497 280.771 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 30 2.44095 Potri.012G127500.1.v4.1 977 878 1739 269.772 ==> SRR3207984.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207984 completed mapping pipeline successfully