Starting /dee2/code/volunteer_pipeline.sh SRR3207985 current disk space = 3052519190528 free memory = 1523009008 SRR3207985 SRAfilesize 0f53b2220c8c03bdab81ef7a46be44c7 SRR3207985.sra SRR3207985.sra file validated SRR3207985 is single end SRR3207985 is conventional basespace SRR3207985 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207985_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14325 34.0 33.0 34.0 31.0 34.0 2 33.28925 34.0 34.0 34.0 31.0 34.0 3 33.323 34.0 34.0 34.0 31.0 34.0 4 36.60825 37.0 37.0 37.0 35.0 37.0 5 36.471 37.0 37.0 37.0 35.0 37.0 6 36.44325 37.0 37.0 37.0 35.0 37.0 7 36.45075 37.0 37.0 37.0 35.0 37.0 8 36.52075 37.0 37.0 37.0 35.0 37.0 9 38.3355 39.0 39.0 39.0 37.0 39.0 10-11 38.362875 39.0 39.0 39.0 37.0 39.0 12-13 38.382125 39.0 39.0 39.0 37.0 39.0 14-15 39.896 41.0 40.0 41.0 38.0 41.0 16-17 39.921875 41.0 40.0 41.0 38.0 41.0 18-19 39.973124999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.950125 41.0 40.0 41.0 38.0 41.0 22-23 39.884249999999994 41.0 40.0 41.0 38.0 41.0 24-25 39.849875 41.0 40.0 41.0 38.0 41.0 26-27 39.793625 41.0 40.0 41.0 38.0 41.0 28-29 39.567625 41.0 40.0 41.0 37.0 41.0 30-31 39.367875 41.0 40.0 41.0 37.0 41.0 32-33 39.428125 41.0 40.0 41.0 37.0 41.0 34-35 39.116749999999996 41.0 39.0 41.0 36.0 41.0 36-37 39.188 41.0 39.0 41.0 36.0 41.0 38-39 39.131125 41.0 39.0 41.0 36.0 41.0 40-41 39.02075 40.0 39.0 41.0 35.5 41.0 42-43 38.845749999999995 40.5 39.0 41.0 35.0 41.0 44-45 38.759 40.0 38.5 41.0 35.0 41.0 46-47 38.788250000000005 40.0 38.5 41.0 35.0 41.0 48-49 38.697 40.0 39.0 41.0 35.0 41.0 50-51 38.885625 41.0 39.0 41.0 35.0 41.0 52-53 38.884875 41.0 39.0 41.0 35.0 41.0 54-55 38.704 41.0 39.0 41.0 35.0 41.0 56-57 38.4965 41.0 38.5 41.0 34.5 41.0 58-59 38.383375 40.0 38.0 41.0 35.0 41.0 60-61 38.222875 40.0 37.5 41.0 34.5 41.0 62-63 37.8495 40.0 37.0 41.0 34.0 41.0 64-65 37.520125 39.0 36.5 41.0 33.5 41.0 66-67 37.14875 39.0 36.0 41.0 33.5 41.0 68-69 36.73975 39.0 35.0 40.5 33.0 41.0 70-71 36.314625 37.5 35.0 39.5 32.5 41.0 72-73 35.738375000000005 37.0 35.0 39.0 31.5 41.0 74-75 35.40875 36.5 35.0 39.0 32.0 40.5 76-77 34.18625 35.0 34.0 37.0 29.5 39.0 78-79 34.36 35.5 35.0 37.0 30.5 39.0 80-81 34.17400000000001 35.0 35.0 37.0 31.0 38.5 82-83 33.804249999999996 35.0 34.5 36.0 30.5 37.0 84-85 33.4555 35.0 34.0 36.0 30.0 37.0 86-87 33.307125 35.0 34.0 35.5 30.0 36.5 88-89 33.12675 35.0 34.0 35.0 30.0 36.0 90-91 33.040375 35.0 34.0 35.0 30.0 36.0 92-93 32.75775 35.0 34.0 35.0 29.0 36.0 94-95 32.617125 35.0 34.0 35.0 29.0 36.0 96-97 32.53 35.0 34.0 35.0 29.0 35.0 98-99 32.370000000000005 35.0 34.0 35.0 29.0 35.0 100 32.3495 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 3.0 10 2.0 11 4.0 12 4.0 13 3.0 14 3.0 15 0.0 16 8.0 17 9.0 18 8.0 19 7.0 20 10.0 21 9.0 22 11.0 23 5.0 24 7.0 25 15.0 26 15.0 27 12.0 28 28.0 29 23.0 30 27.0 31 45.0 32 50.0 33 78.0 34 124.0 35 178.0 36 268.0 37 793.0 38 1726.0 39 523.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.85 15.35 14.124999999999998 47.675 2 19.15 24.2 37.75 18.9 3 21.825 26.900000000000002 27.725 23.549999999999997 4 22.85 32.75 21.75 22.650000000000002 5 24.10602650662666 36.05901475368842 22.20555138784696 17.62940735183796 6 18.3 37.225 25.424999999999997 19.05 7 17.2 18.65 43.05 21.099999999999998 8 18.85 23.075000000000003 31.175000000000004 26.900000000000002 9 18.975 22.75 32.775 25.5 10-11 21.975 32.550000000000004 24.2875 21.1875 12-13 20.2625 26.525 29.725 23.4875 14-15 20.6375 28.249999999999996 29.2375 21.875 16-17 21.6 28.349999999999998 28.0875 21.9625 18-19 21.7 28.3875 27.787499999999998 22.125 20-21 21.6 27.474999999999998 28.175 22.75 22-23 20.925 29.025000000000002 27.925 22.125 24-25 21.10791546830061 29.298486932599726 28.09803676378642 21.495560835313242 26-27 21.1625 29.825000000000003 27.025 21.987499999999997 28-29 21.279258981099012 28.526724245838025 28.151207910877456 22.042808862185506 30-31 20.56390977443609 29.022556390977446 28.170426065162907 22.24310776942356 32-33 21.625 28.075 27.187499999999996 23.1125 34-35 22.275 28.1625 27.150000000000002 22.412499999999998 36-37 21.1125 28.775000000000002 27.8375 22.275 38-39 21.1875 28.762500000000003 27.250000000000004 22.8 40-41 21.975 27.762500000000003 27.8375 22.425 42-43 20.424999999999997 28.575 28.4375 22.5625 44-45 21.375 28.3625 27.437499999999996 22.825 46-47 22.2625 28.4375 27.075 22.225 48-49 22.05 28.5875 26.637499999999996 22.725 50-51 21.8625 29.1875 26.974999999999998 21.975 52-53 21.875 28.212500000000002 27.1625 22.75 54-55 21.5375 27.875 28.812500000000004 21.775 56-57 21.4875 28.299999999999997 27.750000000000004 22.4625 58-59 22.0625 28.3625 27.975 21.6 60-61 20.8875 29.125 28.512500000000003 21.475 62-63 21.85 27.987499999999997 27.9375 22.225 64-65 21.925 28.275 27.6625 22.1375 66-67 21.9375 27.725 27.400000000000002 22.9375 68-69 22.3125 28.6625 28.212500000000002 20.8125 70-71 22.4625 29.3375 26.8125 21.3875 72-73 22.325 28.5625 27.35 21.762500000000003 74-75 22.2 29.1125 26.924999999999997 21.762500000000003 76-77 22.6125 27.987499999999997 27.35 22.05 78-79 22.2625 27.9375 28.050000000000004 21.75 80-81 21.375 28.549999999999997 28.212500000000002 21.8625 82-83 22.400000000000002 28.549999999999997 27.800000000000004 21.25 84-85 21.15 28.537499999999998 28.275 22.037499999999998 86-87 22.0125 28.725 27.8875 21.375 88-89 22.112499999999997 28.1875 28.625 21.075 90-91 22.7375 28.3625 27.3625 21.5375 92-93 22.3875 28.6875 27.525 21.4 94-95 22.1875 27.6375 28.3125 21.8625 96-97 22.6875 27.6125 28.15 21.55 98-99 21.8125 28.175 28.325 21.6875 100 22.975 26.875 27.35 22.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 1.0 21 2.5 22 2.0 23 1.0 24 2.5 25 3.0 26 3.5 27 7.5 28 11.0 29 14.0 30 20.5 31 27.0 32 34.5 33 51.5 34 68.5 35 77.5 36 95.0 37 110.0 38 140.5 39 181.0 40 206.5 41 221.5 42 232.5 43 257.0 44 268.5 45 272.5 46 268.0 47 238.5 48 216.0 49 182.0 50 145.5 51 127.5 52 111.0 53 91.0 54 58.0 55 47.0 56 42.5 57 32.5 58 27.5 59 16.0 60 11.5 61 12.5 62 10.5 63 9.5 64 10.5 65 8.0 66 5.0 67 3.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 2.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.13749999999999998 30-31 0.25 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895784 spots for SRR3207985.sra Written 895784 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra Read 895770 spots for SRR3207985.sra Written 895770 spots for SRR3207985.sra SRR ids: ['SRR3207985.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w5dv0fp2 SRR3207985.sra spots: 17915414 blocks: [[1, 895770], [895771, 1791540], [1791541, 2687310], [2687311, 3583080], [3583081, 4478850], [4478851, 5374620], [5374621, 6270390], [6270391, 7166160], [7166161, 8061930], [8061931, 8957700], [8957701, 9853470], [9853471, 10749240], [10749241, 11645010], [11645011, 12540780], [12540781, 13436550], [13436551, 14332320], [14332321, 15228090], [15228091, 16123860], [16123861, 17019630], [17019631, 17915414]] SRR3207985 file size 4651640 SRR3207985 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207985 SRR3207985_1.fastq Input file: SRR3207985_1.fastq trimmed: SRR3207985-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:54:07 2025 >> started Tue Feb 11 22:54:16 2025 >> done (9.527s) 17915414 reads processed; of these: 3183 ( 0.02%) short reads filtered out after trimming by size control 10856 ( 0.06%) empty reads filtered out after trimming by size control 17901375 (99.92%) reads available; of these: 816190 ( 4.56%) trimmed reads available after processing 17085185 (95.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 471 0.00% 19 528 0.00% 20 645 0.00% 21 832 0.00% 22 1083 0.01% 23 1553 0.01% 24 2053 0.01% 25 2649 0.01% 26 3319 0.02% 27 3110 0.02% 28 2846 0.02% 29 2811 0.02% 30 2611 0.01% 31 2744 0.02% 32 2900 0.02% 33 2848 0.02% 34 3025 0.02% 35 3167 0.02% 36 3326 0.02% 37 3454 0.02% 38 3524 0.02% 39 3633 0.02% 40 3728 0.02% 41 3893 0.02% 42 4101 0.02% 43 4141 0.02% 44 4227 0.02% 45 4239 0.02% 46 4355 0.02% 47 4441 0.02% 48 4646 0.03% 49 4672 0.03% 50 4503 0.03% 51 4828 0.03% 52 4937 0.03% 53 5177 0.03% 54 5068 0.03% 55 5415 0.03% 56 5612 0.03% 57 5714 0.03% 58 5657 0.03% 59 5927 0.03% 60 6115 0.03% 61 6338 0.04% 62 6659 0.04% 63 6581 0.04% 64 6545 0.04% 65 6971 0.04% 66 7094 0.04% 67 7334 0.04% 68 7631 0.04% 69 7723 0.04% 70 8035 0.04% 71 8228 0.05% 72 8740 0.05% 73 8940 0.05% 74 9341 0.05% 75 9407 0.05% 76 6914 0.04% 77 7553 0.04% 78 8454 0.05% 79 9237 0.05% 80 9671 0.05% 81 10423 0.06% 82 11147 0.06% 83 12084 0.07% 84 12279 0.07% 85 13253 0.07% 86 14199 0.08% 87 14708 0.08% 88 16259 0.09% 89 17857 0.10% 90 19278 0.11% 91 22090 0.12% 92 24616 0.14% 93 27814 0.16% 94 32623 0.18% 95 37711 0.21% 96 44370 0.25% 97 53083 0.30% 98 58647 0.33% 99 61825 0.35% 100 17085185 95.44% 17901375 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.90 fanout-score-rank=19 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=18 fanout-score=322.92 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=29.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 22:54:35 Started mapping on | Feb 11 22:54:35 Finished on | Feb 11 22:54:57 Mapping speed, Million of reads per hour | 2929.32 Number of input reads | 17901375 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 16886671 Uniquely mapped reads % | 94.33% Average mapped length | 98.89 Number of splices: Total | 4949119 Number of splices: Annotated (sjdb) | 4863601 Number of splices: GT/AG | 4873253 Number of splices: GC/AG | 62802 Number of splices: AT/AC | 5026 Number of splices: Non-canonical | 8038 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398170 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 204706 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616534 616534 616534 N_multimapping 398170 398170 398170 N_noFeature 736789 8723978 8783029 N_ambiguous 172657 28078 28355 UnstrandedReadsAssigned:15977225 PositiveStrandReadsAssigned:8134615 NegativeStrandReadsAssigned:8075287 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207985 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207985-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,901,375 reads, 16,471,425 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR3207985.ke.tsv 34699 SRR3207985.se.tsv 87100 total ==> SRR3207985.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 513 23.5089 Potri.005G024800.1.v4.1 1035 936 115 10.8047 Potri.004G059700.1.v4.1 961 862 11 1.12221 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 239.2 7.3964 Potri.016G087400.1.v4.1 270 171 585 300.849 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 57 2.99439 Potri.012G127500.1.v4.1 977 878 3715 372.095 ==> SRR3207985.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1686 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 316 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 53 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207985 completed mapping pipeline successfully