Starting /dee2/code/volunteer_pipeline.sh SRR3207986 current disk space = 3052513918976 free memory = 1505865336 SRR3207986 SRAfilesize 9285b2749d001d8659fc0dd99138c844 SRR3207986.sra SRR3207986.sra file validated SRR3207986 is single end SRR3207986 is conventional basespace SRR3207986 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207986_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06475 34.0 33.0 34.0 31.0 34.0 2 33.2185 34.0 34.0 34.0 31.0 34.0 3 33.27675 34.0 34.0 34.0 31.0 34.0 4 36.56475 37.0 37.0 37.0 35.0 37.0 5 36.46875 37.0 37.0 37.0 35.0 37.0 6 36.31325 37.0 37.0 37.0 35.0 37.0 7 36.38275 37.0 37.0 37.0 35.0 37.0 8 36.31675 37.0 37.0 37.0 35.0 37.0 9 38.21075 39.0 39.0 39.0 37.0 39.0 10-11 38.23625 39.0 39.0 39.0 37.0 39.0 12-13 38.303125 39.0 39.0 39.0 37.0 39.0 14-15 39.983625 41.0 40.0 41.0 38.0 41.0 16-17 39.789 41.0 40.0 41.0 37.5 41.0 18-19 39.7975 41.0 40.0 41.0 38.0 41.0 20-21 39.883125 41.0 40.0 41.0 38.0 41.0 22-23 39.715125 41.0 40.0 41.0 37.0 41.0 24-25 39.59125 41.0 40.0 41.0 37.0 41.0 26-27 39.6175 41.0 40.0 41.0 37.5 41.0 28-29 39.65 41.0 40.0 41.0 38.0 41.0 30-31 39.48925 41.0 40.0 41.0 37.0 41.0 32-33 39.3655 41.0 40.0 41.0 36.5 41.0 34-35 39.421 41.0 40.0 41.0 37.0 41.0 36-37 39.331125 41.0 40.0 41.0 36.5 41.0 38-39 39.262375 41.0 39.5 41.0 36.0 41.0 40-41 39.165125 41.0 39.0 41.0 36.0 41.0 42-43 39.009625 41.0 39.0 41.0 35.5 41.0 44-45 39.044375 41.0 39.0 41.0 35.5 41.0 46-47 38.92475 41.0 39.0 41.0 35.5 41.0 48-49 38.964375000000004 41.0 39.0 41.0 35.5 41.0 50-51 39.07575 41.0 39.0 41.0 35.5 41.0 52-53 39.09075 41.0 39.0 41.0 35.5 41.0 54-55 38.958124999999995 41.0 39.0 41.0 35.0 41.0 56-57 38.46475 41.0 38.0 41.0 34.5 41.0 58-59 38.53425 41.0 38.0 41.0 35.0 41.0 60-61 38.404875 40.0 37.5 41.0 35.0 41.0 62-63 38.178375 40.0 37.0 41.0 35.0 41.0 64-65 37.728 39.5 37.0 41.0 34.0 41.0 66-67 37.414 39.0 36.0 41.0 34.0 41.0 68-69 37.019625000000005 39.0 35.5 41.0 34.0 41.0 70-71 36.364625000000004 37.5 35.0 39.5 33.0 41.0 72-73 35.655875 37.0 35.0 39.0 32.0 41.0 74-75 35.229749999999996 36.5 35.0 39.0 31.5 40.5 76-77 34.2665 35.5 34.5 37.0 30.5 39.0 78-79 34.47025 35.5 35.0 37.0 31.5 39.0 80-81 34.221999999999994 35.0 35.0 37.0 32.0 38.5 82-83 33.932375 35.0 35.0 36.0 31.0 37.0 84-85 33.657624999999996 35.0 35.0 36.0 31.5 37.0 86-87 33.381 35.0 35.0 36.0 31.0 36.5 88-89 33.136875 35.0 34.5 35.0 31.0 36.0 90-91 32.921499999999995 35.0 34.0 35.0 30.0 36.0 92-93 32.92225 35.0 34.0 35.0 30.5 36.0 94-95 32.798875 35.0 34.0 35.0 30.0 36.0 96-97 32.721375 35.0 34.0 35.0 30.0 35.5 98-99 32.581 35.0 34.0 35.0 30.0 35.0 100 32.3885 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 3.0 11 3.0 12 2.0 13 3.0 14 6.0 15 4.0 16 3.0 17 3.0 18 8.0 19 4.0 20 4.0 21 12.0 22 8.0 23 12.0 24 13.0 25 11.0 26 20.0 27 34.0 28 28.0 29 25.0 30 42.0 31 39.0 32 50.0 33 67.0 34 92.0 35 107.0 36 252.0 37 755.0 38 1812.0 39 573.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.825 16.325 12.675 47.175 2 18.8 24.75 39.45 17.0 3 20.95 25.75 29.4 23.9 4 23.5 34.25 18.45 23.799999999999997 5 24.0 34.75 24.075 17.175 6 20.724999999999998 34.75 24.425 20.1 7 16.575 19.05 42.75 21.625 8 18.45 24.099999999999998 30.125 27.325 9 21.325 22.575 31.225 24.875 10-11 23.3875 32.4 23.0125 21.2 12-13 18.975 26.424999999999997 30.325000000000003 24.275 14-15 20.025000000000002 27.925 29.225 22.825 16-17 22.55 27.425 26.325 23.7 18-19 20.9 28.375 28.1125 22.6125 20-21 22.1 27.712500000000002 28.050000000000004 22.1375 22-23 20.9 28.9875 27.275 22.8375 24-25 20.31757939484871 27.91947986996749 28.169542385596397 23.593398349587396 26-27 22.1875 28.050000000000004 26.687499999999996 23.075000000000003 28-29 21.188986232790988 29.499374217772218 27.334167709637047 21.97747183979975 30-31 21.8436873747495 27.404809619238478 27.993486973947896 22.75801603206413 32-33 20.7625 27.875 27.900000000000002 23.4625 34-35 21.587500000000002 27.200000000000003 28.725 22.4875 36-37 21.05 28.812500000000004 26.1625 23.974999999999998 38-39 21.4875 28.8875 27.375 22.25 40-41 21.3125 28.175 28.275 22.237499999999997 42-43 21.825 27.8625 28.4375 21.875 44-45 21.8 28.3125 26.487500000000004 23.400000000000002 46-47 21.8875 27.650000000000002 28.075 22.3875 48-49 22.0 28.537499999999998 27.675 21.7875 50-51 21.95 27.0 28.0625 22.9875 52-53 22.1375 27.962500000000002 27.487499999999997 22.412499999999998 54-55 21.575 27.150000000000002 28.125 23.150000000000002 56-57 21.125 29.312500000000004 27.6375 21.925 58-59 21.575 27.750000000000004 27.650000000000002 23.025000000000002 60-61 22.1875 28.575 27.875 21.3625 62-63 22.3875 27.8875 28.025 21.7 64-65 21.337500000000002 29.4875 27.3 21.875 66-67 21.6125 29.599999999999998 27.1375 21.65 68-69 21.4125 30.025000000000002 27.8375 20.724999999999998 70-71 21.8125 29.037499999999998 26.3125 22.8375 72-73 20.6125 28.212500000000002 28.262500000000003 22.912499999999998 74-75 20.925 29.212500000000002 27.950000000000003 21.912499999999998 76-77 21.6875 27.8875 28.7 21.725 78-79 21.45 28.475 27.875 22.2 80-81 22.075 27.800000000000004 27.5625 22.5625 82-83 21.1875 28.7375 28.499999999999996 21.575 84-85 21.575 28.475 27.025 22.925 86-87 21.875 28.712500000000002 28.549999999999997 20.8625 88-89 21.525 27.287499999999998 29.3375 21.85 90-91 21.6625 28.425 28.325 21.587500000000002 92-93 21.9 29.1375 26.937499999999996 22.025 94-95 21.3875 29.099999999999998 27.55 21.9625 96-97 21.775 27.787499999999998 27.975 22.4625 98-99 21.875 28.7 28.1375 21.2875 100 22.55 29.625 26.6 21.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 1.0 24 2.5 25 3.0 26 3.5 27 6.0 28 9.5 29 13.5 30 20.0 31 28.0 32 35.0 33 38.0 34 55.0 35 78.0 36 94.5 37 117.0 38 138.5 39 177.0 40 198.0 41 189.0 42 216.5 43 254.0 44 269.5 45 282.5 46 276.0 47 261.5 48 238.0 49 194.5 50 163.5 51 146.5 52 126.0 53 91.0 54 63.0 55 49.0 56 39.0 57 31.5 58 23.0 59 16.5 60 11.0 61 7.0 62 6.0 63 5.0 64 3.5 65 2.5 66 1.5 67 2.0 68 2.0 69 1.0 70 1.0 71 1.0 72 0.0 73 0.5 74 1.5 75 1.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.125 30-31 0.2 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59005892902896 97.175 2 0.3074558032282859 0.6 3 0.025621316935690495 0.075 4 0.0 0.0 5 0.025621316935690495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025621316935690495 0.7250000000000001 >50 0.025621316935690495 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 52 1.3 TruSeq Adapter, Index 4 (100% over 50bp) CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAG 29 0.7250000000000001 Illumina Multiplexing PCR Primer 2.01 (100% over 30bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATG 5 0.125 TruSeq Adapter, Index 4 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.5 0.0 0.0 0.0 0.0 22-23 0.875 0.0 0.0 0.0 0.0 24-25 0.875 0.0 0.0 0.0 0.0 26-27 0.875 0.0 0.0 0.0 0.0 28-29 0.875 0.0 0.0 0.0 0.0 30-31 0.875 0.0125 0.0 0.0 0.0 32-33 0.875 0.025 0.0 0.0 0.0 34-35 0.875 0.025 0.0 0.0 0.0 36-37 0.875 0.025 0.0 0.0 0.0 38-39 0.875 0.025 0.0 0.0 0.0 40-41 0.875 0.025 0.0 0.0 0.0 42-43 0.875 0.025 0.0 0.0 0.0 44-45 0.875 0.025 0.0 0.0 0.0 46-47 0.875 0.025 0.0 0.0 0.0 48-49 0.875 0.025 0.0 0.0 0.0 50-51 0.875 0.025 0.0 0.0 0.0 52-53 0.875 0.025 0.0 0.0 0.0 54-55 0.875 0.025 0.0 0.0 0.0 56-57 0.875 0.025 0.0 0.0 0.0 58-59 0.8875 0.025 0.0 0.0 0.0 60-61 0.9 0.025 0.0 0.0 0.0 62-63 0.9125000000000001 0.025 0.0 0.0 0.0 64-65 0.95 0.025 0.0 0.0 0.0 66-67 0.95 0.025 0.0 0.0 0.0 68-69 0.975 0.025 0.0 0.0 0.0 70-71 1.0 0.025 0.0 0.0 0.0 72-73 1.0375 0.025 0.0 0.0 0.0 74-75 1.075 0.025 0.0 0.0 0.0 76-77 1.1125 0.025 0.0 0.0 0.0 78-79 1.15 0.025 0.0 0.0 0.0 80-81 1.15 0.025 0.0 0.0 0.0 82-83 1.175 0.025 0.0 0.0 0.0 84-85 1.1875 0.025 0.0 0.0 0.0 86-87 1.2625000000000002 0.025 0.0 0.0 0.0 88 1.325 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584346 spots for SRR3207986.sra Written 584346 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra Read 584330 spots for SRR3207986.sra Written 584330 spots for SRR3207986.sra SRR ids: ['SRR3207986.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dkadl8bd SRR3207986.sra spots: 11686616 blocks: [[1, 584330], [584331, 1168660], [1168661, 1752990], [1752991, 2337320], [2337321, 2921650], [2921651, 3505980], [3505981, 4090310], [4090311, 4674640], [4674641, 5258970], [5258971, 5843300], [5843301, 6427630], [6427631, 7011960], [7011961, 7596290], [7596291, 8180620], [8180621, 8764950], [8764951, 9349280], [9349281, 9933610], [9933611, 10517940], [10517941, 11102270], [11102271, 11686616]] SRR3207986 file size 3030579 SRR3207986 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207986 SRR3207986_1.fastq Input file: SRR3207986_1.fastq trimmed: SRR3207986-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:54:16 2025 >> started Tue Feb 11 22:54:24 2025 >> done (8.242s) 11686616 reads processed; of these: 2373 ( 0.02%) short reads filtered out after trimming by size control 136712 ( 1.17%) empty reads filtered out after trimming by size control 11547531 (98.81%) reads available; of these: 553424 ( 4.79%) trimmed reads available after processing 10994107 (95.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 387 0.00% 19 964 0.01% 20 36874 0.32% 21 1267 0.01% 22 769 0.01% 23 1468 0.01% 24 1894 0.02% 25 2063 0.02% 26 2791 0.02% 27 2032 0.02% 28 1955 0.02% 29 2725 0.02% 30 1768 0.02% 31 2390 0.02% 32 1882 0.02% 33 1766 0.02% 34 1998 0.02% 35 2383 0.02% 36 2368 0.02% 37 2538 0.02% 38 2961 0.03% 39 2284 0.02% 40 2732 0.02% 41 2280 0.02% 42 2451 0.02% 43 2583 0.02% 44 2892 0.03% 45 2874 0.02% 46 2760 0.02% 47 3054 0.03% 48 3055 0.03% 49 2932 0.03% 50 2923 0.03% 51 2883 0.02% 52 3355 0.03% 53 3320 0.03% 54 3495 0.03% 55 3366 0.03% 56 3741 0.03% 57 4305 0.04% 58 4061 0.04% 59 4351 0.04% 60 4400 0.04% 61 4480 0.04% 62 4840 0.04% 63 8683 0.08% 64 5351 0.05% 65 4964 0.04% 66 5843 0.05% 67 5166 0.04% 68 6025 0.05% 69 6002 0.05% 70 5524 0.05% 71 4976 0.04% 72 5156 0.04% 73 5207 0.05% 74 5416 0.05% 75 5242 0.05% 76 3842 0.03% 77 4201 0.04% 78 4806 0.04% 79 5037 0.04% 80 5494 0.05% 81 5837 0.05% 82 6646 0.06% 83 7167 0.06% 84 7481 0.06% 85 7635 0.07% 86 7923 0.07% 87 8876 0.08% 88 10324 0.09% 89 13082 0.11% 90 15077 0.13% 91 13211 0.11% 92 13638 0.12% 93 15447 0.13% 94 17866 0.15% 95 21742 0.19% 96 24383 0.21% 97 28881 0.25% 98 33540 0.29% 99 43073 0.37% 100 10994107 95.21% 11547531 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=41.14 fanout-score-rank=9 prefix-density=0.41 prefix-fanout=31.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAGAAGAGCACAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=243.18 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=26.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:54:39 Started mapping on | Feb 11 22:54:40 Finished on | Feb 11 22:54:56 Mapping speed, Million of reads per hour | 2598.19 Number of input reads | 11547531 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 10955874 Uniquely mapped reads % | 94.88% Average mapped length | 98.94 Number of splices: Total | 3305883 Number of splices: Annotated (sjdb) | 3248115 Number of splices: GT/AG | 3256844 Number of splices: GC/AG | 40544 Number of splices: AT/AC | 3307 Number of splices: Non-canonical | 5188 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273768 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 37741 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 317889 317889 317889 N_multimapping 273768 273768 273768 N_noFeature 478100 5650293 5705609 N_ambiguous 114726 18440 18403 UnstrandedReadsAssigned:10363048 PositiveStrandReadsAssigned:5287141 NegativeStrandReadsAssigned:5231862 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207986 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207986-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,547,531 reads, 10,593,438 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR3207986.ke.tsv 34699 SRR3207986.se.tsv 87100 total ==> SRR3207986.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 321 23.7613 Potri.005G024800.1.v4.1 1035 936 24 3.6423 Potri.004G059700.1.v4.1 961 862 18 2.96623 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 175.233 8.75236 Potri.016G087400.1.v4.1 270 171 318 264.163 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 3.13969 Potri.012G127500.1.v4.1 977 878 1238 200.293 ==> SRR3207986.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1337 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207986 completed mapping pipeline successfully