Starting /dee2/code/volunteer_pipeline.sh SRR3207987 current disk space = 3052248903680 free memory = 1577687596 SRR3207987 SRAfilesize 205ac0d1bf58a54f02e840dfa09cc372 SRR3207987.sra SRR3207987.sra file validated SRR3207987 is single end SRR3207987 is conventional basespace SRR3207987 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207987_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.115 34.0 33.0 34.0 31.0 34.0 2 33.2715 34.0 34.0 34.0 31.0 34.0 3 33.37675 34.0 34.0 34.0 31.0 34.0 4 36.59775 37.0 37.0 37.0 35.0 37.0 5 36.5395 37.0 37.0 37.0 35.0 37.0 6 36.4115 37.0 37.0 37.0 35.0 37.0 7 36.4535 37.0 37.0 37.0 35.0 37.0 8 36.37675 37.0 37.0 37.0 35.0 37.0 9 38.24225 39.0 39.0 39.0 37.0 39.0 10-11 38.27075 39.0 39.0 39.0 37.0 39.0 12-13 38.399125 39.0 39.0 39.0 37.0 39.0 14-15 40.04875 41.0 40.0 41.0 38.0 41.0 16-17 39.904875000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.872749999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.942499999999995 41.0 40.0 41.0 38.0 41.0 22-23 39.803250000000006 41.0 40.0 41.0 38.0 41.0 24-25 39.8125 41.0 40.0 41.0 38.0 41.0 26-27 39.847375 41.0 40.0 41.0 38.0 41.0 28-29 39.696875 41.0 40.0 41.0 38.0 41.0 30-31 39.5705 41.0 40.0 41.0 37.0 41.0 32-33 39.483999999999995 41.0 40.0 41.0 37.0 41.0 34-35 39.4875 41.0 40.0 41.0 37.0 41.0 36-37 39.396 41.0 40.0 41.0 37.0 41.0 38-39 39.27825 41.0 40.0 41.0 36.5 41.0 40-41 39.230000000000004 41.0 39.0 41.0 36.0 41.0 42-43 39.179125 41.0 39.0 41.0 36.5 41.0 44-45 39.202625 41.0 39.0 41.0 36.5 41.0 46-47 39.175 41.0 39.0 41.0 36.0 41.0 48-49 39.14725 41.0 39.0 41.0 36.0 41.0 50-51 39.236875 41.0 39.5 41.0 36.0 41.0 52-53 39.2715 41.0 39.0 41.0 36.0 41.0 54-55 39.14575 41.0 39.0 41.0 36.0 41.0 56-57 38.63275 41.0 38.5 41.0 34.5 41.0 58-59 38.76875 41.0 39.0 41.0 35.0 41.0 60-61 38.567125000000004 40.0 38.0 41.0 35.0 41.0 62-63 38.3565 40.0 37.0 41.0 35.0 41.0 64-65 38.008 39.5 37.0 41.0 34.0 41.0 66-67 37.635625000000005 39.0 36.0 41.0 34.0 41.0 68-69 37.273375 39.0 36.0 41.0 34.0 41.0 70-71 36.567625 37.5 35.0 40.0 34.0 41.0 72-73 36.033625 37.0 35.0 39.0 33.0 41.0 74-75 35.552375 36.5 35.0 39.0 32.0 40.5 76-77 34.6275 36.0 34.5 37.0 30.5 39.0 78-79 34.757125 36.0 35.0 37.0 32.0 39.0 80-81 34.539125 35.0 35.0 37.0 32.5 39.0 82-83 34.259125 35.0 35.0 36.0 32.0 37.0 84-85 34.0 35.0 35.0 36.0 32.0 37.0 86-87 33.761250000000004 35.0 35.0 36.0 32.0 37.0 88-89 33.619875 35.0 35.0 35.5 32.0 36.0 90-91 33.349375 35.0 34.5 35.0 31.0 36.0 92-93 33.329125 35.0 35.0 35.0 31.5 36.0 94-95 33.219750000000005 35.0 35.0 35.0 31.0 36.0 96-97 33.06325 35.0 34.5 35.0 31.0 36.0 98-99 32.967875 35.0 34.0 35.0 31.0 35.0 100 32.788 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 6.0 12 1.0 13 2.0 14 4.0 15 4.0 16 3.0 17 2.0 18 4.0 19 6.0 20 4.0 21 5.0 22 4.0 23 7.0 24 12.0 25 11.0 26 19.0 27 32.0 28 24.0 29 27.0 30 21.0 31 32.0 32 52.0 33 63.0 34 71.0 35 145.0 36 238.0 37 710.0 38 1864.0 39 621.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.825 16.05 14.549999999999999 42.575 2 18.925 25.374999999999996 38.95 16.75 3 20.775 27.275 29.65 22.3 4 21.875 33.525 20.775 23.825 5 24.55 35.55 21.75 18.15 6 19.45 35.925000000000004 24.224999999999998 20.4 7 15.2 19.3 43.824999999999996 21.675 8 19.85 23.625 31.75 24.775 9 21.3 22.05 31.674999999999997 24.975 10-11 23.525 32.2 23.3 20.974999999999998 12-13 20.1375 26.5125 29.812499999999996 23.5375 14-15 21.0125 28.15 29.037499999999998 21.8 16-17 21.6625 27.150000000000002 28.3625 22.825 18-19 21.725 27.450000000000003 27.825 23.0 20-21 23.1125 28.225 26.937499999999996 21.725 22-23 21.5375 29.825000000000003 27.625 21.0125 24-25 20.78019504876219 28.244561140285075 28.432108027006752 22.543135783945985 26-27 21.6125 28.799999999999997 27.650000000000002 21.9375 28-29 22.245868803204807 28.75563345017526 27.12819228843265 21.870305458187282 30-31 21.317635270541082 28.331663326653306 27.78056112224449 22.57014028056112 32-33 21.0375 29.275000000000002 27.737499999999997 21.95 34-35 21.825 28.512500000000003 27.6 22.0625 36-37 22.6875 28.0875 27.5875 21.637500000000003 38-39 21.55 28.375 28.299999999999997 21.775 40-41 20.9125 28.812500000000004 28.8875 21.3875 42-43 21.337500000000002 27.700000000000003 28.1125 22.85 44-45 22.45 28.1875 27.025 22.3375 46-47 22.0625 28.525 28.299999999999997 21.1125 48-49 22.275 28.9375 27.6125 21.175 50-51 21.125 28.1 27.3875 23.3875 52-53 21.512500000000003 29.125 27.575 21.7875 54-55 21.1375 27.6625 28.625 22.575 56-57 22.0875 28.0625 28.175 21.675 58-59 22.325 28.1375 28.3375 21.2 60-61 21.5375 28.375 27.8875 22.2 62-63 22.575 27.725 28.475 21.224999999999998 64-65 22.3125 28.962500000000002 27.675 21.05 66-67 21.4125 29.4375 27.925 21.224999999999998 68-69 21.462500000000002 29.425 27.462500000000002 21.65 70-71 22.3 28.775000000000002 27.650000000000002 21.275 72-73 20.6375 29.262500000000003 28.425 21.675 74-75 21.712500000000002 29.312500000000004 28.262500000000003 20.7125 76-77 22.162499999999998 29.15 27.825 20.8625 78-79 21.4125 28.799999999999997 28.7 21.087500000000002 80-81 22.2625 28.125 27.400000000000002 22.2125 82-83 22.3 28.525 27.8875 21.2875 84-85 21.337500000000002 27.6625 28.4125 22.5875 86-87 20.8875 29.4125 27.875 21.825 88-89 21.8125 28.762500000000003 27.8625 21.5625 90-91 21.9375 28.599999999999998 27.712500000000002 21.75 92-93 21.6125 30.0 26.637499999999996 21.75 94-95 20.8 29.8375 27.987499999999997 21.375 96-97 21.475 28.549999999999997 27.5625 22.412499999999998 98-99 21.975 27.650000000000002 28.037499999999998 22.3375 100 22.225 27.85 28.499999999999996 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.5 25 2.0 26 3.0 27 5.5 28 9.5 29 16.5 30 22.0 31 23.0 32 30.5 33 51.0 34 68.5 35 81.5 36 89.5 37 117.5 38 154.5 39 173.0 40 201.0 41 222.5 42 243.0 43 274.5 44 280.5 45 268.5 46 264.0 47 264.5 48 228.0 49 181.5 50 160.5 51 127.0 52 98.0 53 76.0 54 66.5 55 50.0 56 29.0 57 25.5 58 17.5 59 14.0 60 14.5 61 9.5 62 5.5 63 4.5 64 2.5 65 3.5 66 2.5 67 1.5 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.15 30-31 0.2 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89860583016477 98.52499999999999 2 0.07604562737642585 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025348542458808618 1.325 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 53 1.325 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825867 spots for SRR3207987.sra Written 825867 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra Read 825849 spots for SRR3207987.sra Written 825849 spots for SRR3207987.sra SRR ids: ['SRR3207987.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f4n8htlt SRR3207987.sra spots: 16516998 blocks: [[1, 825849], [825850, 1651698], [1651699, 2477547], [2477548, 3303396], [3303397, 4129245], [4129246, 4955094], [4955095, 5780943], [5780944, 6606792], [6606793, 7432641], [7432642, 8258490], [8258491, 9084339], [9084340, 9910188], [9910189, 10736037], [10736038, 11561886], [11561887, 12387735], [12387736, 13213584], [13213585, 14039433], [14039434, 14865282], [14865283, 15691131], [15691132, 16516998]] SRR3207987 file size 4287677 SRR3207987 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207987 SRR3207987_1.fastq Input file: SRR3207987_1.fastq trimmed: SRR3207987-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:31:55 2025 >> started Tue Feb 11 23:32:03 2025 >> done (8.513s) 16516998 reads processed; of these: 1948 ( 0.01%) short reads filtered out after trimming by size control 228553 ( 1.38%) empty reads filtered out after trimming by size control 16286497 (98.60%) reads available; of these: 635653 ( 3.90%) trimmed reads available after processing 15650844 (96.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 309 0.00% 19 411 0.00% 20 516 0.00% 21 568 0.00% 22 720 0.00% 23 999 0.01% 24 1333 0.01% 25 1659 0.01% 26 1851 0.01% 27 1825 0.01% 28 1764 0.01% 29 1814 0.01% 30 1858 0.01% 31 1863 0.01% 32 1993 0.01% 33 2100 0.01% 34 2238 0.01% 35 2287 0.01% 36 2393 0.01% 37 2499 0.02% 38 2540 0.02% 39 2575 0.02% 40 2575 0.02% 41 2771 0.02% 42 2858 0.02% 43 2924 0.02% 44 3008 0.02% 45 3107 0.02% 46 3178 0.02% 47 3358 0.02% 48 3439 0.02% 49 3539 0.02% 50 3570 0.02% 51 3722 0.02% 52 3952 0.02% 53 3800 0.02% 54 4165 0.03% 55 4065 0.02% 56 4381 0.03% 57 4468 0.03% 58 4506 0.03% 59 4823 0.03% 60 4962 0.03% 61 5048 0.03% 62 5195 0.03% 63 5934 0.04% 64 5447 0.03% 65 5499 0.03% 66 5916 0.04% 67 5992 0.04% 68 7272 0.04% 69 7662 0.05% 70 7429 0.05% 71 6402 0.04% 72 6555 0.04% 73 6683 0.04% 74 6939 0.04% 75 6707 0.04% 76 5120 0.03% 77 5685 0.03% 78 6272 0.04% 79 6924 0.04% 80 7267 0.04% 81 8034 0.05% 82 8331 0.05% 83 8975 0.06% 84 9186 0.06% 85 9918 0.06% 86 10397 0.06% 87 11146 0.07% 88 12214 0.07% 89 13571 0.08% 90 14585 0.09% 91 16495 0.10% 92 18457 0.11% 93 20791 0.13% 94 24680 0.15% 95 28490 0.17% 96 33811 0.21% 97 40149 0.25% 98 46755 0.29% 99 60434 0.37% 100 15650844 96.10% 16286497 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=37.47 fanout-score-rank=12 prefix-density=0.31 prefix-fanout=29.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=293.25 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.8 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:32:21 Started mapping on | Feb 11 23:32:21 Finished on | Feb 11 23:32:38 Mapping speed, Million of reads per hour | 3448.91 Number of input reads | 16286497 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15666487 Uniquely mapped reads % | 96.19% Average mapped length | 99.01 Number of splices: Total | 4795021 Number of splices: Annotated (sjdb) | 4712442 Number of splices: GT/AG | 4722736 Number of splices: GC/AG | 60078 Number of splices: AT/AC | 4916 Number of splices: Non-canonical | 7291 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346737 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 53972 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 273273 273273 273273 N_multimapping 346737 346737 346737 N_noFeature 672257 8086022 8151950 N_ambiguous 152515 25849 26144 UnstrandedReadsAssigned:14841715 PositiveStrandReadsAssigned:7554616 NegativeStrandReadsAssigned:7488393 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207987 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207987-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,286,497 reads, 15,171,837 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR3207987.ke.tsv 34699 SRR3207987.se.tsv 87100 total ==> SRR3207987.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 439 22.4763 Potri.005G024800.1.v4.1 1035 936 52 5.45836 Potri.004G059700.1.v4.1 961 862 40 4.55919 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 241.543 8.34447 Potri.016G087400.1.v4.1 270 171 510 293.028 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 68.5656 4.02426 Potri.012G127500.1.v4.1 977 878 2640 295.423 ==> SRR3207987.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1486 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 63 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207987 completed mapping pipeline successfully