Starting /dee2/code/volunteer_pipeline.sh SRR3207988 current disk space = 3052471906304 free memory = 1415750368 SRR3207988 SRAfilesize d6cb8f39ce0113bb31059abdfc46a485 SRR3207988.sra SRR3207988.sra file validated SRR3207988 is single end SRR3207988 is conventional basespace SRR3207988 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207988_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1775 34.0 33.0 34.0 31.0 34.0 2 33.36875 34.0 34.0 34.0 31.0 34.0 3 33.40125 34.0 34.0 34.0 31.0 34.0 4 36.64225 37.0 37.0 37.0 35.0 37.0 5 36.603 37.0 37.0 37.0 35.0 37.0 6 36.52775 37.0 37.0 37.0 35.0 37.0 7 36.50525 37.0 37.0 37.0 35.0 37.0 8 36.56225 37.0 37.0 37.0 35.0 37.0 9 38.40975 39.0 39.0 39.0 37.0 39.0 10-11 38.42425 39.0 39.0 39.0 37.0 39.0 12-13 38.407624999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.935625 41.0 40.0 41.0 38.0 41.0 16-17 40.047625 41.0 40.0 41.0 38.0 41.0 18-19 40.037000000000006 41.0 40.0 41.0 38.0 41.0 20-21 40.03875 41.0 40.0 41.0 38.0 41.0 22-23 40.017624999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.898375 41.0 40.0 41.0 38.0 41.0 26-27 39.86 41.0 40.0 41.0 38.0 41.0 28-29 39.7325 41.0 40.0 41.0 38.0 41.0 30-31 39.570125000000004 41.0 40.0 41.0 37.5 41.0 32-33 39.567875 41.0 40.0 41.0 37.0 41.0 34-35 39.32225 41.0 39.5 41.0 36.0 41.0 36-37 39.315250000000006 41.0 39.0 41.0 37.0 41.0 38-39 39.2435 41.0 39.0 41.0 36.0 41.0 40-41 39.142624999999995 40.5 39.0 41.0 36.0 41.0 42-43 39.046125 40.5 39.0 41.0 36.0 41.0 44-45 38.980500000000006 40.0 39.0 41.0 35.5 41.0 46-47 38.957125 41.0 39.0 41.0 35.0 41.0 48-49 38.88849999999999 40.0 39.0 41.0 35.0 41.0 50-51 39.068749999999994 41.0 39.0 41.0 36.0 41.0 52-53 39.036874999999995 41.0 39.0 41.0 35.0 41.0 54-55 38.789625 41.0 39.0 41.0 35.0 41.0 56-57 38.664625 40.5 39.0 41.0 35.0 41.0 58-59 38.429375 40.0 38.0 41.0 35.0 41.0 60-61 38.25625 40.0 37.5 41.0 35.0 41.0 62-63 37.933375 40.0 37.0 41.0 34.0 41.0 64-65 37.68725 39.5 36.5 41.0 34.0 41.0 66-67 37.199250000000006 39.0 36.0 41.0 33.5 41.0 68-69 36.888000000000005 38.5 35.5 40.5 33.5 41.0 70-71 36.47675 37.5 35.0 40.0 33.0 41.0 72-73 35.783249999999995 37.0 35.0 39.0 32.0 41.0 74-75 35.3885 36.5 35.0 39.0 32.0 40.5 76-77 34.292625 35.0 34.0 37.0 30.0 39.0 78-79 34.399625 35.0 35.0 37.0 31.0 39.0 80-81 34.172875 35.0 35.0 37.0 31.0 39.0 82-83 33.804249999999996 35.0 34.5 36.0 31.0 37.0 84-85 33.547125 35.0 34.0 36.0 30.5 37.0 86-87 33.36425 35.0 34.0 35.5 30.5 37.0 88-89 33.155125 35.0 34.0 35.0 30.0 36.0 90-91 32.993375 35.0 34.0 35.0 30.0 36.0 92-93 32.82575 35.0 34.0 35.0 30.0 36.0 94-95 32.666624999999996 35.0 34.0 35.0 30.0 36.0 96-97 32.5505 35.0 34.0 35.0 29.0 35.0 98-99 32.355625 35.0 34.0 35.0 29.0 35.0 100 32.29275 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 5.0 11 1.0 12 4.0 13 1.0 14 5.0 15 5.0 16 4.0 17 5.0 18 6.0 19 7.0 20 7.0 21 7.0 22 10.0 23 15.0 24 6.0 25 11.0 26 14.0 27 19.0 28 27.0 29 20.0 30 31.0 31 40.0 32 49.0 33 75.0 34 101.0 35 144.0 36 306.0 37 823.0 38 1704.0 39 547.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.349999999999998 15.174999999999999 15.4 45.074999999999996 2 20.125 23.9 36.925000000000004 19.05 3 19.625 28.449999999999996 28.375 23.549999999999997 4 23.375 32.574999999999996 21.45 22.6 5 24.23105776444111 35.08377094273568 22.705676419104776 17.97949487371843 6 18.75 37.75 24.625 18.875 7 15.625 18.425 44.425 21.525 8 18.2 23.775 30.925000000000004 27.1 9 21.125 22.475 31.05 25.35 10-11 22.35 33.6625 22.8125 21.175 12-13 20.175 26.6625 29.8875 23.275000000000002 14-15 21.0 27.987499999999997 29.1125 21.9 16-17 22.275 27.787499999999998 28.15 21.7875 18-19 21.4 29.099999999999998 27.2625 22.237499999999997 20-21 22.15 28.599999999999998 27.575 21.675 22-23 21.0375 29.4875 27.0625 22.412499999999998 24-25 20.690086260782596 29.55369421177647 28.066008251031377 21.690211276409553 26-27 20.7875 29.262500000000003 27.450000000000003 22.5 28-29 21.248124062031014 28.77688844422211 28.151575787893947 21.823411705852926 30-31 21.329327825760423 28.351483289523095 28.288897233696332 22.030291651020153 32-33 21.0125 28.7 27.5875 22.7 34-35 22.3625 27.800000000000004 27.474999999999998 22.3625 36-37 21.2625 28.6625 27.175 22.900000000000002 38-39 21.5 28.962500000000002 27.700000000000003 21.837500000000002 40-41 22.237499999999997 28.65 26.737499999999997 22.375 42-43 21.275 29.2 27.762500000000003 21.762500000000003 44-45 21.625 28.725 27.55 22.1 46-47 22.425 27.900000000000002 27.775 21.9 48-49 20.7625 28.025 28.6625 22.55 50-51 21.55 27.987499999999997 28.287499999999998 22.175 52-53 22.662499999999998 27.250000000000004 27.275 22.8125 54-55 22.3875 28.199999999999996 27.725 21.6875 56-57 21.8 28.1875 27.650000000000002 22.3625 58-59 22.275 26.937499999999996 28.5875 22.2 60-61 22.025 27.975 28.299999999999997 21.7 62-63 21.349999999999998 27.775 28.025 22.85 64-65 21.55 28.775000000000002 27.962500000000002 21.712500000000002 66-67 22.0875 28.212500000000002 27.750000000000004 21.95 68-69 21.4125 29.325000000000003 28.012500000000003 21.25 70-71 22.0 28.975 28.3125 20.7125 72-73 21.637500000000003 28.6125 28.012500000000003 21.7375 74-75 22.412499999999998 27.925 28.012500000000003 21.65 76-77 22.4375 28.537499999999998 26.8375 22.1875 78-79 21.675 28.325 28.4125 21.587500000000002 80-81 22.2625 28.4375 27.5125 21.7875 82-83 22.0 28.512500000000003 28.625 20.8625 84-85 22.0 28.075 28.0625 21.8625 86-87 21.775 27.6375 27.925 22.662499999999998 88-89 22.825 27.9125 27.737499999999997 21.525 90-91 22.1 27.4125 28.825 21.6625 92-93 21.85 28.1 28.349999999999998 21.7 94-95 22.162499999999998 28.849999999999998 27.3 21.6875 96-97 22.25 27.575 28.5875 21.587500000000002 98-99 21.45 27.9375 28.512500000000003 22.1 100 22.575 28.075 26.950000000000003 22.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 3.5 24 4.0 25 5.0 26 5.0 27 9.0 28 15.5 29 18.5 30 22.0 31 27.5 32 35.5 33 46.5 34 59.0 35 75.5 36 101.5 37 123.5 38 137.5 39 162.0 40 198.5 41 224.5 42 237.0 43 258.0 44 268.0 45 276.0 46 266.5 47 230.5 48 203.0 49 184.5 50 163.5 51 130.0 52 109.5 53 91.5 54 67.0 55 46.5 56 39.0 57 37.0 58 26.0 59 18.0 60 11.5 61 9.0 62 9.5 63 7.0 64 7.0 65 7.5 66 6.0 67 3.5 68 1.5 69 1.5 70 1.5 71 1.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.05 30-31 0.13749999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82407640110581 99.3 2 0.12565971349585323 0.25 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025131942699170642 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575423 spots for SRR3207988.sra Written 575423 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra Read 575421 spots for SRR3207988.sra Written 575421 spots for SRR3207988.sra SRR ids: ['SRR3207988.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8t3mybcx SRR3207988.sra spots: 11508422 blocks: [[1, 575421], [575422, 1150842], [1150843, 1726263], [1726264, 2301684], [2301685, 2877105], [2877106, 3452526], [3452527, 4027947], [4027948, 4603368], [4603369, 5178789], [5178790, 5754210], [5754211, 6329631], [6329632, 6905052], [6905053, 7480473], [7480474, 8055894], [8055895, 8631315], [8631316, 9206736], [9206737, 9782157], [9782158, 10357578], [10357579, 10932999], [10933000, 11508422]] SRR3207988 file size 2984222 SRR3207988 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207988 SRR3207988_1.fastq Input file: SRR3207988_1.fastq trimmed: SRR3207988-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 22:51:48 2025 >> started Tue Feb 11 22:51:53 2025 >> done (5.530s) 11508422 reads processed; of these: 2389 ( 0.02%) short reads filtered out after trimming by size control 43574 ( 0.38%) empty reads filtered out after trimming by size control 11462459 (99.60%) reads available; of these: 519616 ( 4.53%) trimmed reads available after processing 10942843 (95.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 306 0.00% 19 361 0.00% 20 502 0.00% 21 541 0.00% 22 682 0.01% 23 952 0.01% 24 1265 0.01% 25 1677 0.01% 26 2069 0.02% 27 1892 0.02% 28 1767 0.02% 29 1726 0.02% 30 1707 0.01% 31 1733 0.02% 32 1893 0.02% 33 1791 0.02% 34 1947 0.02% 35 1983 0.02% 36 2135 0.02% 37 2222 0.02% 38 2260 0.02% 39 2298 0.02% 40 2299 0.02% 41 2508 0.02% 42 2586 0.02% 43 2611 0.02% 44 2654 0.02% 45 2571 0.02% 46 2834 0.02% 47 2928 0.03% 48 2896 0.03% 49 2955 0.03% 50 2884 0.03% 51 3047 0.03% 52 3203 0.03% 53 3315 0.03% 54 3400 0.03% 55 3499 0.03% 56 3579 0.03% 57 3644 0.03% 58 3759 0.03% 59 3859 0.03% 60 3971 0.03% 61 4074 0.04% 62 4207 0.04% 63 4262 0.04% 64 4518 0.04% 65 4895 0.04% 66 4634 0.04% 67 4759 0.04% 68 4765 0.04% 69 4992 0.04% 70 5301 0.05% 71 5700 0.05% 72 5796 0.05% 73 5808 0.05% 74 5734 0.05% 75 5826 0.05% 76 4286 0.04% 77 4621 0.04% 78 5240 0.05% 79 5667 0.05% 80 6206 0.05% 81 6466 0.06% 82 7039 0.06% 83 7640 0.07% 84 7840 0.07% 85 8437 0.07% 86 8830 0.08% 87 9437 0.08% 88 10139 0.09% 89 11232 0.10% 90 12286 0.11% 91 13933 0.12% 92 15571 0.14% 93 17270 0.15% 94 20417 0.18% 95 23870 0.21% 96 28502 0.25% 97 33466 0.29% 98 37929 0.33% 99 39310 0.34% 100 10942843 95.47% 11462459 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=6.79 fanout-score-rank=20 prefix-density=0.04 prefix-fanout=6.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=6 fanout-score=264.89 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 22:52:12 Started mapping on | Feb 11 22:52:12 Finished on | Feb 11 22:52:26 Mapping speed, Million of reads per hour | 2947.49 Number of input reads | 11462459 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 10770323 Uniquely mapped reads % | 93.96% Average mapped length | 98.91 Number of splices: Total | 3148641 Number of splices: Annotated (sjdb) | 3091792 Number of splices: GT/AG | 3100835 Number of splices: GC/AG | 39479 Number of splices: AT/AC | 3253 Number of splices: Non-canonical | 5074 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263842 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 83503 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 428294 428294 428294 N_multimapping 263842 263842 263842 N_noFeature 502884 5583797 5618410 N_ambiguous 109156 18984 19290 UnstrandedReadsAssigned:10158283 PositiveStrandReadsAssigned:5167542 NegativeStrandReadsAssigned:5132623 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207988 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207988-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,462,459 reads, 10,443,914 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR3207988.ke.tsv 34699 SRR3207988.se.tsv 87100 total ==> SRR3207988.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 313 22.5138 Potri.005G024800.1.v4.1 1035 936 156 23.0053 Potri.004G059700.1.v4.1 961 862 20 3.20259 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 205.186 9.95859 Potri.016G087400.1.v4.1 270 171 379 305.93 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 44 3.62807 Potri.012G127500.1.v4.1 977 878 1729 271.819 ==> SRR3207988.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 890 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207988 completed mapping pipeline successfully