Starting /dee2/code/volunteer_pipeline.sh SRR3207989 current disk space = 3052079763456 free memory = 1576313284 SRR3207989 SRAfilesize 4f5e41851b06f838b2f277197e63e72d SRR3207989.sra SRR3207989.sra file validated SRR3207989 is single end SRR3207989 is conventional basespace SRR3207989 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207989_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16225 34.0 33.0 34.0 31.0 34.0 2 33.3185 34.0 34.0 34.0 31.0 34.0 3 33.3335 34.0 34.0 34.0 31.0 34.0 4 36.59775 37.0 37.0 37.0 35.0 37.0 5 36.52775 37.0 37.0 37.0 35.0 37.0 6 36.487 37.0 37.0 37.0 35.0 37.0 7 36.421 37.0 37.0 37.0 35.0 37.0 8 36.49325 37.0 37.0 37.0 35.0 37.0 9 38.3145 39.0 39.0 39.0 37.0 39.0 10-11 38.39675 39.0 39.0 39.0 37.0 39.0 12-13 38.3875 39.0 39.0 39.0 37.0 39.0 14-15 39.930125000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.97475 41.0 40.0 41.0 38.0 41.0 18-19 40.002625 41.0 40.0 41.0 38.0 41.0 20-21 39.919624999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.872749999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.857625 41.0 40.0 41.0 38.0 41.0 26-27 39.744125 41.0 40.0 41.0 38.0 41.0 28-29 39.605375 41.0 40.0 41.0 37.0 41.0 30-31 39.4915 41.0 40.0 41.0 37.0 41.0 32-33 39.39375 41.0 40.0 41.0 37.0 41.0 34-35 39.056375 41.0 39.0 41.0 36.0 41.0 36-37 39.173874999999995 41.0 39.0 41.0 36.0 41.0 38-39 39.077 40.5 39.0 41.0 36.0 41.0 40-41 38.995374999999996 40.0 39.0 41.0 36.0 41.0 42-43 38.875875 40.5 39.0 41.0 35.0 41.0 44-45 38.651875000000004 40.0 38.5 41.0 34.5 41.0 46-47 38.633375 40.0 39.0 41.0 35.0 41.0 48-49 38.574625 40.0 38.0 41.0 35.0 41.0 50-51 38.803 41.0 39.0 41.0 35.0 41.0 52-53 38.80525 41.0 39.0 41.0 35.0 41.0 54-55 38.582 41.0 38.5 41.0 34.5 41.0 56-57 38.465125 40.0 38.0 41.0 35.0 41.0 58-59 38.248000000000005 40.0 38.0 41.0 34.0 41.0 60-61 38.10125 40.0 37.0 41.0 34.0 41.0 62-63 37.786249999999995 40.0 37.0 41.0 34.0 41.0 64-65 37.469125000000005 39.0 36.0 41.0 34.0 41.0 66-67 37.040625 39.0 36.0 41.0 33.0 41.0 68-69 36.667375 38.5 35.0 40.5 32.5 41.0 70-71 36.253249999999994 37.0 35.0 39.5 32.5 41.0 72-73 35.628625 37.0 35.0 39.0 32.0 41.0 74-75 35.319625 36.0 35.0 39.0 32.0 40.5 76-77 34.263125 35.0 34.0 37.0 30.0 39.0 78-79 34.38675 35.0 35.0 37.0 31.0 39.0 80-81 34.182625 35.0 35.0 36.5 31.0 38.0 82-83 33.797 35.0 34.5 36.0 31.0 37.0 84-85 33.422875000000005 35.0 34.0 36.0 30.0 37.0 86-87 33.258250000000004 35.0 34.0 35.5 30.0 36.5 88-89 33.097 35.0 34.0 35.0 30.0 36.0 90-91 32.924499999999995 35.0 34.0 35.0 30.0 36.0 92-93 32.704375 35.0 34.0 35.0 29.0 36.0 94-95 32.596000000000004 35.0 34.0 35.0 29.0 35.0 96-97 32.443125 35.0 34.0 35.0 29.0 35.0 98-99 32.318875 35.0 34.0 35.0 29.0 35.0 100 32.19475 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 5.0 11 5.0 12 3.0 13 7.0 14 4.0 15 4.0 16 4.0 17 10.0 18 6.0 19 4.0 20 8.0 21 12.0 22 5.0 23 13.0 24 8.0 25 9.0 26 17.0 27 13.0 28 22.0 29 29.0 30 25.0 31 47.0 32 68.0 33 86.0 34 99.0 35 149.0 36 323.0 37 817.0 38 1721.0 39 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.724999999999998 14.299999999999999 14.924999999999999 47.05 2 21.05 21.825 36.075 21.05 3 22.3 25.1 26.6 26.0 4 24.5 31.95 20.599999999999998 22.95 5 25.1 34.275 22.75 17.875 6 19.6 36.625 23.674999999999997 20.1 7 16.75 18.2 44.275 20.775 8 18.65 22.75 31.025000000000002 27.575 9 20.025000000000002 22.55 32.625 24.8 10-11 22.112499999999997 32.574999999999996 23.849999999999998 21.462500000000002 12-13 20.3125 26.8375 29.612500000000004 23.2375 14-15 21.337500000000002 27.6875 28.6125 22.3625 16-17 21.7875 28.6125 26.9125 22.6875 18-19 21.9375 28.025 27.462500000000002 22.575 20-21 22.7 28.037499999999998 27.462500000000002 21.8 22-23 21.55 29.1625 27.8375 21.45 24-25 22.240280035004375 27.453431678959873 27.453431678959873 22.852856607075882 26-27 22.325 28.025 27.975 21.675 28-29 22.85571392848212 28.632158039509875 26.744186046511626 21.767941985496375 30-31 20.600375234521575 29.005628517823638 28.19262038774234 22.201375859912446 32-33 22.35 28.712500000000002 26.2625 22.675 34-35 21.349999999999998 28.050000000000004 27.8625 22.7375 36-37 21.4 27.5125 28.075 23.0125 38-39 21.525 27.762500000000003 27.950000000000003 22.7625 40-41 22.3375 28.050000000000004 27.762500000000003 21.85 42-43 21.075 28.037499999999998 27.6375 23.25 44-45 22.0125 28.050000000000004 27.700000000000003 22.237499999999997 46-47 22.95 27.975 26.9125 22.162499999999998 48-49 22.1375 28.4125 27.987499999999997 21.462500000000002 50-51 21.912499999999998 28.8625 26.387500000000003 22.8375 52-53 21.7375 28.625 27.787499999999998 21.85 54-55 21.5 28.8875 27.400000000000002 22.2125 56-57 21.9375 27.900000000000002 27.8625 22.3 58-59 22.5875 27.9125 27.325 22.175 60-61 22.05 27.5625 28.0625 22.325 62-63 22.125 28.1875 27.4125 22.275 64-65 22.475 27.55 27.6 22.375 66-67 22.237499999999997 28.3875 27.625 21.75 68-69 22.475 27.1125 27.8875 22.525000000000002 70-71 22.025 28.1625 27.6375 22.175 72-73 21.2875 28.6375 27.900000000000002 22.175 74-75 22.5625 28.125 27.3875 21.925 76-77 21.912499999999998 29.0875 27.9125 21.087500000000002 78-79 22.45 27.9375 27.525 22.0875 80-81 22.0875 27.287499999999998 28.549999999999997 22.075 82-83 22.162499999999998 28.625 27.05 22.162499999999998 84-85 22.9375 27.987499999999997 27.450000000000003 21.625 86-87 21.75 28.462500000000002 28.075 21.712500000000002 88-89 23.150000000000002 27.500000000000004 27.5125 21.837500000000002 90-91 21.925 28.325 27.6125 22.1375 92-93 22.325 27.287499999999998 28.175 22.2125 94-95 21.912499999999998 28.025 27.925 22.1375 96-97 23.275000000000002 27.5125 27.925 21.2875 98-99 21.987499999999997 27.9375 27.9375 22.1375 100 23.5 28.425 25.575 22.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 2.5 27 3.0 28 3.5 29 8.0 30 12.0 31 13.0 32 21.0 33 36.0 34 47.5 35 62.5 36 73.0 37 92.0 38 128.0 39 156.0 40 197.0 41 239.5 42 264.5 43 289.0 44 293.5 45 277.0 46 284.5 47 271.0 48 225.5 49 193.0 50 169.5 51 135.5 52 104.5 53 91.5 54 76.0 55 58.0 56 40.5 57 26.5 58 18.5 59 15.5 60 10.0 61 9.5 62 9.5 63 6.5 64 7.5 65 8.5 66 4.0 67 1.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.025 30-31 0.0625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606511 spots for SRR3207989.sra Written 606511 spots for SRR3207989.sra Read 606527 spots for SRR3207989.sra Written 606527 spots for SRR3207989.sra SRR ids: ['SRR3207989.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s5u6v2bn SRR3207989.sra spots: 12130236 blocks: [[1, 606511], [606512, 1213022], [1213023, 1819533], [1819534, 2426044], [2426045, 3032555], [3032556, 3639066], [3639067, 4245577], [4245578, 4852088], [4852089, 5458599], [5458600, 6065110], [6065111, 6671621], [6671622, 7278132], [7278133, 7884643], [7884644, 8491154], [8491155, 9097665], [9097666, 9704176], [9704177, 10310687], [10310688, 10917198], [10917199, 11523709], [11523710, 12130236]] SRR3207989 file size 3146039 SRR3207989 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207989 SRR3207989_1.fastq Input file: SRR3207989_1.fastq trimmed: SRR3207989-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:48:05 2025 >> started Tue Feb 11 23:48:11 2025 >> done (6.133s) 12130236 reads processed; of these: 1890 ( 0.02%) short reads filtered out after trimming by size control 13730 ( 0.11%) empty reads filtered out after trimming by size control 12114616 (99.87%) reads available; of these: 570719 ( 4.71%) trimmed reads available after processing 11543897 (95.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 240 0.00% 19 295 0.00% 20 371 0.00% 21 459 0.00% 22 575 0.00% 23 910 0.01% 24 1158 0.01% 25 1479 0.01% 26 2276 0.02% 27 2116 0.02% 28 1652 0.01% 29 1599 0.01% 30 1658 0.01% 31 1534 0.01% 32 1723 0.01% 33 1747 0.01% 34 1855 0.02% 35 1946 0.02% 36 1950 0.02% 37 2044 0.02% 38 2106 0.02% 39 2122 0.02% 40 2286 0.02% 41 2268 0.02% 42 2571 0.02% 43 2668 0.02% 44 2687 0.02% 45 2746 0.02% 46 2839 0.02% 47 2797 0.02% 48 2824 0.02% 49 2954 0.02% 50 2968 0.02% 51 3015 0.02% 52 3173 0.03% 53 3392 0.03% 54 3297 0.03% 55 3539 0.03% 56 3580 0.03% 57 3879 0.03% 58 3743 0.03% 59 3912 0.03% 60 4073 0.03% 61 4274 0.04% 62 4291 0.04% 63 4415 0.04% 64 4542 0.04% 65 4533 0.04% 66 4863 0.04% 67 4984 0.04% 68 5071 0.04% 69 5191 0.04% 70 5633 0.05% 71 6001 0.05% 72 6127 0.05% 73 6416 0.05% 74 6817 0.06% 75 6628 0.05% 76 4678 0.04% 77 5216 0.04% 78 5992 0.05% 79 6497 0.05% 80 6820 0.06% 81 7176 0.06% 82 7831 0.06% 83 8477 0.07% 84 8849 0.07% 85 9464 0.08% 86 9953 0.08% 87 10743 0.09% 88 11873 0.10% 89 12686 0.10% 90 13965 0.12% 91 15643 0.13% 92 17850 0.15% 93 20145 0.17% 94 23716 0.20% 95 27590 0.23% 96 32465 0.27% 97 38559 0.32% 98 42805 0.35% 99 44914 0.37% 100 11543897 95.29% 12114616 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=28 prefix-density=0.08 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=308.26 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=28.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 23:48:30 Started mapping on | Feb 11 23:48:30 Finished on | Feb 11 23:48:43 Mapping speed, Million of reads per hour | 3354.82 Number of input reads | 12114616 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 11521101 Uniquely mapped reads % | 95.10% Average mapped length | 99.02 Number of splices: Total | 3587870 Number of splices: Annotated (sjdb) | 3529193 Number of splices: GT/AG | 3535648 Number of splices: GC/AG | 44039 Number of splices: AT/AC | 3680 Number of splices: Non-canonical | 4503 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266083 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 187967 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327432 327432 327432 N_multimapping 266083 266083 266083 N_noFeature 407710 5875667 5980302 N_ambiguous 110956 18839 19428 UnstrandedReadsAssigned:11002435 PositiveStrandReadsAssigned:5626595 NegativeStrandReadsAssigned:5521371 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207989 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207989-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,114,616 reads, 11,378,466 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR3207989.ke.tsv 34699 SRR3207989.se.tsv 87100 total ==> SRR3207989.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 327 22.465 Potri.005G024800.1.v4.1 1035 936 27 3.80296 Potri.004G059700.1.v4.1 961 862 15 2.29413 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 185.088 8.57992 Potri.016G087400.1.v4.1 270 171 377 290.656 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 41 3.22896 Potri.012G127500.1.v4.1 977 878 1404 210.818 ==> SRR3207989.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1232 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207989 completed mapping pipeline successfully