Starting /dee2/code/volunteer_pipeline.sh SRR3207990 current disk space = 3052381859840 free memory = 1366001192 SRR3207990 SRAfilesize ff71f97db0e8894e355fa57d7c8ce8c6 SRR3207990.sra SRR3207990.sra file validated SRR3207990 is single end SRR3207990 is conventional basespace SRR3207990 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.114 34.0 33.0 34.0 31.0 34.0 2 33.29425 34.0 34.0 34.0 31.0 34.0 3 33.31825 34.0 34.0 34.0 31.0 34.0 4 36.615 37.0 37.0 37.0 35.0 37.0 5 36.54125 37.0 37.0 37.0 35.0 37.0 6 36.53375 37.0 37.0 37.0 35.0 37.0 7 36.49775 37.0 37.0 37.0 35.0 37.0 8 36.5215 37.0 37.0 37.0 35.0 37.0 9 38.38375 39.0 39.0 39.0 37.0 39.0 10-11 38.38525 39.0 39.0 39.0 37.0 39.0 12-13 38.382875 39.0 39.0 39.0 37.0 39.0 14-15 39.920125 41.0 40.0 41.0 38.0 41.0 16-17 40.0005 41.0 40.0 41.0 38.0 41.0 18-19 39.97025 41.0 40.0 41.0 38.0 41.0 20-21 39.9535 41.0 40.0 41.0 38.0 41.0 22-23 39.909499999999994 41.0 40.0 41.0 38.0 41.0 24-25 39.806875 41.0 40.0 41.0 38.0 41.0 26-27 39.71675 41.0 40.0 41.0 38.0 41.0 28-29 39.6025 41.0 40.0 41.0 37.0 41.0 30-31 39.532 41.0 40.0 41.0 37.5 41.0 32-33 39.491 41.0 40.0 41.0 37.0 41.0 34-35 39.122749999999996 41.0 39.0 41.0 36.0 41.0 36-37 39.202 41.0 39.0 41.0 36.0 41.0 38-39 39.077124999999995 41.0 39.0 41.0 36.0 41.0 40-41 38.9645 40.0 39.0 41.0 35.5 41.0 42-43 38.89775 40.5 38.5 41.0 35.5 41.0 44-45 38.806625 40.0 39.0 41.0 35.0 41.0 46-47 38.794375 40.0 39.0 41.0 35.0 41.0 48-49 38.685375 40.0 38.5 41.0 35.0 41.0 50-51 38.850125 41.0 39.0 41.0 35.0 41.0 52-53 38.87625 41.0 39.0 41.0 35.0 41.0 54-55 38.66325 41.0 39.0 41.0 35.0 41.0 56-57 38.57725 40.5 38.0 41.0 35.0 41.0 58-59 38.37925 40.0 38.0 41.0 34.0 41.0 60-61 38.29 40.0 37.5 41.0 34.0 41.0 62-63 37.8825 40.0 37.0 41.0 34.0 41.0 64-65 37.596000000000004 39.0 36.0 41.0 34.0 41.0 66-67 37.19 39.0 36.0 41.0 33.0 41.0 68-69 36.868625 39.0 35.0 40.5 33.0 41.0 70-71 36.409375 37.5 35.0 40.0 32.5 41.0 72-73 35.727875 37.0 35.0 39.0 31.5 41.0 74-75 35.432125 36.5 35.0 39.0 32.0 40.5 76-77 34.298500000000004 35.0 34.0 37.0 30.0 39.0 78-79 34.443749999999994 35.0 34.5 37.0 31.0 39.0 80-81 34.210750000000004 35.0 35.0 37.0 31.0 38.0 82-83 33.7975 35.0 34.5 36.0 30.5 37.0 84-85 33.477625 35.0 34.0 36.0 30.0 37.0 86-87 33.323875 35.0 34.0 35.5 30.5 36.0 88-89 33.183875 35.0 34.0 35.0 30.0 36.0 90-91 33.002250000000004 35.0 34.0 35.0 30.0 36.0 92-93 32.82825 35.0 34.0 35.0 30.0 36.0 94-95 32.559375 35.0 34.0 35.0 29.0 35.0 96-97 32.542500000000004 35.0 34.0 35.0 29.0 35.0 98-99 32.36475 35.0 34.0 35.0 29.0 35.0 100 32.253 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 3.0 10 3.0 11 1.0 12 7.0 13 5.0 14 4.0 15 4.0 16 4.0 17 4.0 18 5.0 19 7.0 20 5.0 21 7.0 22 7.0 23 12.0 24 9.0 25 9.0 26 13.0 27 19.0 28 21.0 29 18.0 30 38.0 31 42.0 32 59.0 33 78.0 34 109.0 35 183.0 36 312.0 37 755.0 38 1749.0 39 505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.65 12.75 15.8 47.8 2 18.6 23.0 37.425000000000004 20.974999999999998 3 22.95 25.25 25.724999999999998 26.075 4 23.275000000000002 31.424999999999997 20.275000000000002 25.025 5 25.312656328164078 35.042521260630316 22.0360180090045 17.608804402201102 6 18.9 37.05 24.675 19.375 7 16.400000000000002 16.825000000000003 45.9 20.875 8 19.650000000000002 21.775 31.125000000000004 27.450000000000003 9 20.175 21.525 33.45 24.85 10-11 22.6 32.15 23.150000000000002 22.1 12-13 20.0 26.3125 30.9625 22.725 14-15 21.55 28.037499999999998 28.5625 21.85 16-17 21.6875 28.725 27.9375 21.65 18-19 21.5 28.3375 27.400000000000002 22.7625 20-21 22.825 27.750000000000004 27.287499999999998 22.1375 22-23 22.237499999999997 28.075 27.487499999999997 22.2 24-25 21.620607727897962 28.87332749781168 27.19769913717644 22.308365637113916 26-27 21.6 28.8375 27.6125 21.95 28-29 22.751719824890557 27.529706066291432 27.754846779237024 21.963727329580987 30-31 21.681471287376457 28.487426498185915 27.64919304391342 22.181909170524207 32-33 22.0625 28.65 26.924999999999997 22.3625 34-35 22.787499999999998 27.8875 27.437499999999996 21.8875 36-37 21.5375 27.750000000000004 27.6125 23.1 38-39 22.037499999999998 28.499999999999996 27.275 22.1875 40-41 22.2625 27.437499999999996 27.775 22.525000000000002 42-43 21.775 27.487499999999997 27.675 23.0625 44-45 21.6125 27.725 28.1 22.5625 46-47 21.9625 28.1875 27.0875 22.7625 48-49 22.075 28.3875 27.075 22.4625 50-51 22.787499999999998 28.075 26.900000000000002 22.237499999999997 52-53 22.7 28.375 27.275 21.65 54-55 22.237499999999997 27.762500000000003 27.737499999999997 22.2625 56-57 23.1875 28.012500000000003 26.4125 22.3875 58-59 21.5375 28.787499999999998 27.400000000000002 22.275 60-61 21.987499999999997 27.437499999999996 28.787499999999998 21.7875 62-63 21.875 28.012500000000003 27.85 22.2625 64-65 21.725 27.8875 27.737499999999997 22.650000000000002 66-67 22.375 27.1125 27.962500000000002 22.55 68-69 22.175 28.15 27.8625 21.8125 70-71 22.6 27.487499999999997 27.5125 22.400000000000002 72-73 22.4875 27.3375 28.000000000000004 22.175 74-75 22.25 26.85 28.175 22.725 76-77 21.725 27.55 27.900000000000002 22.825 78-79 22.287499999999998 27.900000000000002 27.325 22.4875 80-81 22.55 26.775 27.925 22.75 82-83 22.0625 27.5625 27.474999999999998 22.900000000000002 84-85 21.9 28.175 28.050000000000004 21.875 86-87 22.237499999999997 28.549999999999997 26.5375 22.675 88-89 22.3625 27.875 27.85 21.912499999999998 90-91 21.762500000000003 28.212500000000002 28.000000000000004 22.025 92-93 23.25 27.8125 27.525 21.4125 94-95 22.825 27.8375 27.712500000000002 21.625 96-97 22.9625 27.675 27.6875 21.675 98-99 21.9 28.475 27.737499999999997 21.8875 100 22.925 26.224999999999998 29.65 21.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 3.5 27 3.5 28 4.5 29 7.5 30 8.5 31 13.5 32 22.0 33 29.5 34 47.0 35 63.5 36 78.5 37 99.5 38 129.5 39 166.5 40 204.0 41 231.5 42 255.5 43 269.5 44 281.0 45 277.0 46 257.0 47 248.5 48 237.5 49 218.0 50 176.5 51 141.0 52 118.0 53 87.5 54 65.5 55 55.0 56 41.5 57 31.0 58 20.5 59 16.5 60 17.5 61 12.5 62 8.0 63 5.5 64 6.0 65 6.0 66 3.5 67 5.5 68 7.0 69 3.0 70 0.5 71 1.0 72 2.0 73 2.0 74 1.0 75 1.0 76 1.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.0625 30-31 0.08750000000000001 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933405 spots for SRR3207990.sra Written 933405 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra Read 933391 spots for SRR3207990.sra Written 933391 spots for SRR3207990.sra SRR ids: ['SRR3207990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gry82127 SRR3207990.sra spots: 18667834 blocks: [[1, 933391], [933392, 1866782], [1866783, 2800173], [2800174, 3733564], [3733565, 4666955], [4666956, 5600346], [5600347, 6533737], [6533738, 7467128], [7467129, 8400519], [8400520, 9333910], [9333911, 10267301], [10267302, 11200692], [11200693, 12134083], [12134084, 13067474], [13067475, 14000865], [14000866, 14934256], [14934257, 15867647], [15867648, 16801038], [16801039, 17734429], [17734430, 18667834]] SRR3207990 file size 4847451 SRR3207990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207990 SRR3207990_1.fastq Input file: SRR3207990_1.fastq trimmed: SRR3207990-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:07:47 2025 >> started Tue Feb 11 23:07:56 2025 >> done (9.474s) 18667834 reads processed; of these: 3446 ( 0.02%) short reads filtered out after trimming by size control 9584 ( 0.05%) empty reads filtered out after trimming by size control 18654804 (99.93%) reads available; of these: 862046 ( 4.62%) trimmed reads available after processing 17792758 (95.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 456 0.00% 19 523 0.00% 20 793 0.00% 21 765 0.00% 22 1025 0.01% 23 1445 0.01% 24 1945 0.01% 25 2428 0.01% 26 3026 0.02% 27 2800 0.02% 28 2557 0.01% 29 2573 0.01% 30 2569 0.01% 31 2649 0.01% 32 2656 0.01% 33 2720 0.01% 34 2981 0.02% 35 2985 0.02% 36 3145 0.02% 37 3325 0.02% 38 3481 0.02% 39 3469 0.02% 40 3493 0.02% 41 3727 0.02% 42 3957 0.02% 43 4202 0.02% 44 4263 0.02% 45 4238 0.02% 46 4315 0.02% 47 4369 0.02% 48 4534 0.02% 49 4618 0.02% 50 4572 0.02% 51 4746 0.03% 52 4989 0.03% 53 5010 0.03% 54 5118 0.03% 55 5298 0.03% 56 5549 0.03% 57 5577 0.03% 58 5891 0.03% 59 5899 0.03% 60 6146 0.03% 61 6434 0.03% 62 6509 0.03% 63 6750 0.04% 64 6758 0.04% 65 6940 0.04% 66 7215 0.04% 67 7517 0.04% 68 7905 0.04% 69 7922 0.04% 70 8364 0.04% 71 8711 0.05% 72 9205 0.05% 73 9552 0.05% 74 9743 0.05% 75 10076 0.05% 76 7001 0.04% 77 7715 0.04% 78 8878 0.05% 79 9626 0.05% 80 10329 0.06% 81 10917 0.06% 82 11983 0.06% 83 12836 0.07% 84 13376 0.07% 85 14311 0.08% 86 14983 0.08% 87 16050 0.09% 88 17493 0.09% 89 18993 0.10% 90 21399 0.11% 91 23409 0.13% 92 26577 0.14% 93 30281 0.16% 94 35614 0.19% 95 41623 0.22% 96 48311 0.26% 97 58297 0.31% 98 63824 0.34% 99 67792 0.36% 100 17792758 95.38% 18654804 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=21 prefix-density=0.08 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=300.85 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=28.8 sequence=TTCTTCTTCTTT Started job on | Feb 11 23:08:14 Started mapping on | Feb 11 23:08:15 Finished on | Feb 11 23:08:36 Mapping speed, Million of reads per hour | 3197.97 Number of input reads | 18654804 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17602016 Uniquely mapped reads % | 94.36% Average mapped length | 99.02 Number of splices: Total | 5366820 Number of splices: Annotated (sjdb) | 5274997 Number of splices: GT/AG | 5285458 Number of splices: GC/AG | 68106 Number of splices: AT/AC | 5754 Number of splices: Non-canonical | 7502 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421142 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 518031 % of reads mapped to too many loci | 2.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631646 631646 631646 N_multimapping 421142 421142 421142 N_noFeature 687425 9032177 9147237 N_ambiguous 167951 28945 29212 UnstrandedReadsAssigned:16746640 PositiveStrandReadsAssigned:8540894 NegativeStrandReadsAssigned:8425567 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207990 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207990-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,654,804 reads, 17,519,709 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR3207990.ke.tsv 34699 SRR3207990.se.tsv 87100 total ==> SRR3207990.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 444 19.489 Potri.005G024800.1.v4.1 1035 936 74 6.65944 Potri.004G059700.1.v4.1 961 862 26 2.54067 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 269.276 7.97534 Potri.016G087400.1.v4.1 270 171 670 330.035 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 75 3.77387 Potri.012G127500.1.v4.1 977 878 3003 288.099 ==> SRR3207990.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1671 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR3207990 completed mapping pipeline successfully