Starting /dee2/code/volunteer_pipeline.sh SRR3207991 current disk space = 3052036493312 free memory = 1574261048 SRR3207991 SRAfilesize f30b294babeeaa7da24dfd091abd9548 SRR3207991.sra SRR3207991.sra file validated SRR3207991 is single end SRR3207991 is conventional basespace SRR3207991 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207991_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.185 34.0 33.0 34.0 31.0 34.0 2 33.34325 34.0 34.0 34.0 31.0 34.0 3 33.393 34.0 34.0 34.0 31.0 34.0 4 36.6245 37.0 37.0 37.0 35.0 37.0 5 36.52175 37.0 37.0 37.0 35.0 37.0 6 36.42825 37.0 37.0 37.0 35.0 37.0 7 36.51975 37.0 37.0 37.0 35.0 37.0 8 36.4165 37.0 37.0 37.0 35.0 37.0 9 38.2765 39.0 39.0 39.0 37.0 39.0 10-11 38.314375 39.0 39.0 39.0 37.0 39.0 12-13 38.397000000000006 39.0 39.0 39.0 37.0 39.0 14-15 40.106375 41.0 40.0 41.0 38.0 41.0 16-17 39.917874999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.901375 41.0 40.0 41.0 38.0 41.0 20-21 40.0015 41.0 40.0 41.0 38.0 41.0 22-23 39.865125 41.0 40.0 41.0 38.0 41.0 24-25 39.864374999999995 41.0 40.0 41.0 38.0 41.0 26-27 39.8915 41.0 40.0 41.0 38.0 41.0 28-29 39.806625 41.0 40.0 41.0 38.0 41.0 30-31 39.694375 41.0 40.0 41.0 38.0 41.0 32-33 39.57925 41.0 40.0 41.0 37.0 41.0 34-35 39.682625 41.0 40.0 41.0 37.0 41.0 36-37 39.536375 41.0 40.0 41.0 37.0 41.0 38-39 39.511375 41.0 40.0 41.0 37.0 41.0 40-41 39.3725 41.0 39.5 41.0 36.5 41.0 42-43 39.277625 41.0 39.0 41.0 36.5 41.0 44-45 39.276125 41.0 39.0 41.0 36.0 41.0 46-47 39.251875 41.0 39.0 41.0 36.0 41.0 48-49 39.18575 41.0 39.0 41.0 36.0 41.0 50-51 39.276624999999996 41.0 39.5 41.0 36.0 41.0 52-53 39.341625 41.0 39.5 41.0 36.0 41.0 54-55 39.189625 41.0 39.0 41.0 36.0 41.0 56-57 38.68825 41.0 39.0 41.0 34.5 41.0 58-59 38.83 41.0 39.0 41.0 35.0 41.0 60-61 38.726875 40.0 38.0 41.0 35.0 41.0 62-63 38.546499999999995 40.0 37.5 41.0 35.0 41.0 64-65 38.257999999999996 40.0 37.0 41.0 35.0 41.0 66-67 37.845124999999996 39.0 37.0 41.0 34.0 41.0 68-69 37.532125 39.0 36.0 41.0 34.0 41.0 70-71 37.16525 38.5 35.5 40.5 34.0 41.0 72-73 36.551249999999996 37.0 35.0 39.5 33.0 41.0 74-75 36.133125 37.0 35.0 39.0 33.0 41.0 76-77 35.16175 36.0 34.5 39.0 31.5 39.0 78-79 35.221875 36.0 35.0 37.0 32.5 39.0 80-81 35.077 35.5 35.0 37.0 33.0 39.0 82-83 34.74125 35.0 35.0 36.5 33.0 37.5 84-85 34.384625 35.0 35.0 36.0 33.0 37.0 86-87 34.114625000000004 35.0 35.0 36.0 32.0 37.0 88-89 33.918 35.0 35.0 35.5 32.0 36.0 90-91 33.714 35.0 35.0 35.0 31.5 36.0 92-93 33.664375 35.0 35.0 35.0 32.0 36.0 94-95 33.555875 35.0 35.0 35.0 32.0 36.0 96-97 33.418625 35.0 34.5 35.0 32.0 35.5 98-99 33.345375000000004 35.0 34.5 35.0 32.0 35.0 100 33.13425 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 2.0 16 3.0 17 9.0 18 3.0 19 3.0 20 4.0 21 8.0 22 3.0 23 4.0 24 7.0 25 5.0 26 9.0 27 14.0 28 18.0 29 27.0 30 28.0 31 36.0 32 41.0 33 65.0 34 101.0 35 133.0 36 233.0 37 683.0 38 1867.0 39 685.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.075 15.275 11.875 46.775 2 19.35 21.325 38.85 20.474999999999998 3 22.125 24.625 26.75 26.5 4 24.825 31.2 20.75 23.225 5 25.275 36.225 20.849999999999998 17.65 6 19.075 37.9 25.025 18.0 7 15.975 21.275 44.1 18.65 8 19.2 23.75 32.300000000000004 24.75 9 19.275000000000002 23.474999999999998 33.95 23.3 10-11 22.0125 33.225 23.9875 20.775 12-13 19.7625 27.200000000000003 30.912499999999998 22.125 14-15 21.087500000000002 28.6375 29.299999999999997 20.974999999999998 16-17 21.725 28.5875 27.8375 21.85 18-19 21.587500000000002 29.062500000000004 28.499999999999996 20.849999999999998 20-21 21.675 28.775000000000002 28.050000000000004 21.5 22-23 21.57769721215152 28.766095761970245 27.703462932866607 21.952744093011624 24-25 21.788617886178862 28.705440900562852 28.367729831144466 21.138211382113823 26-27 21.5625 28.3875 28.512500000000003 21.5375 28-29 21.629740893728876 28.58931030166479 28.313931656027037 21.467017148579295 30-31 21.036814425244177 28.92561983471074 28.061607813673927 21.97595792637115 32-33 20.8875 28.625 27.500000000000004 22.9875 34-35 20.1375 30.475 27.487499999999997 21.9 36-37 21.9375 29.1625 27.575 21.325 38-39 22.475 28.237499999999997 27.6125 21.675 40-41 21.025 29.575000000000003 28.287499999999998 21.1125 42-43 21.7375 29.349999999999998 27.762500000000003 21.15 44-45 20.837500000000002 29.6625 28.375 21.125 46-47 21.75 28.4125 28.962500000000002 20.875 48-49 21.6 28.4125 27.962500000000002 22.025 50-51 21.912499999999998 28.599999999999998 28.675 20.8125 52-53 21.575 28.975 27.762500000000003 21.6875 54-55 21.4875 27.725 28.4 22.3875 56-57 20.7375 29.625 28.1875 21.45 58-59 21.2 29.012500000000003 28.9125 20.875 60-61 21.3125 28.6375 29.275000000000002 20.775 62-63 21.15 28.787499999999998 27.962500000000002 22.1 64-65 21.325 28.8875 28.4375 21.349999999999998 66-67 21.425 29.849999999999998 28.1375 20.5875 68-69 21.349999999999998 29.812499999999996 27.3875 21.45 70-71 21.512500000000003 28.5875 28.7375 21.1625 72-73 21.4375 28.375 28.299999999999997 21.8875 74-75 21.224999999999998 28.762500000000003 28.1 21.912499999999998 76-77 21.8625 29.2375 27.275 21.625 78-79 22.4375 28.462500000000002 28.487499999999997 20.6125 80-81 22.0625 28.475 27.787499999999998 21.675 82-83 21.4125 29.212500000000002 28.1 21.275 84-85 21.8125 28.299999999999997 28.375 21.512500000000003 86-87 20.8875 29.45 28.199999999999996 21.462500000000002 88-89 22.175 28.5625 27.650000000000002 21.6125 90-91 21.5375 29.362500000000004 28.15 20.95 92-93 22.0875 28.9375 27.5875 21.3875 94-95 21.075 28.625 28.037499999999998 22.2625 96-97 21.3625 28.749999999999996 28.3375 21.55 98-99 22.15 27.487499999999997 27.675 22.6875 100 21.65 28.425 28.199999999999996 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 2.0 25 3.5 26 4.0 27 6.5 28 12.5 29 15.5 30 19.5 31 23.0 32 43.0 33 68.5 34 68.5 35 79.0 36 111.5 37 125.0 38 156.5 39 194.0 40 225.0 41 264.5 42 273.5 43 271.5 44 277.0 45 261.5 46 225.0 47 217.5 48 221.5 49 183.0 50 141.0 51 118.5 52 92.5 53 75.5 54 53.5 55 39.5 56 29.5 57 15.0 58 14.0 59 13.5 60 11.0 61 6.0 62 5.5 63 7.0 64 3.5 65 2.0 66 3.0 67 2.0 68 1.0 69 0.5 70 0.5 71 2.5 72 2.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0625 26-27 0.0 28-29 0.13749999999999998 30-31 0.17500000000000002 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676164 spots for SRR3207991.sra Written 676164 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra Read 676154 spots for SRR3207991.sra Written 676154 spots for SRR3207991.sra SRR ids: ['SRR3207991.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jbnwj9pw SRR3207991.sra spots: 13523090 blocks: [[1, 676154], [676155, 1352308], [1352309, 2028462], [2028463, 2704616], [2704617, 3380770], [3380771, 4056924], [4056925, 4733078], [4733079, 5409232], [5409233, 6085386], [6085387, 6761540], [6761541, 7437694], [7437695, 8113848], [8113849, 8790002], [8790003, 9466156], [9466157, 10142310], [10142311, 10818464], [10818465, 11494618], [11494619, 12170772], [12170773, 12846926], [12846927, 13523090]] SRR3207991 file size 3508509 SRR3207991 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207991 SRR3207991_1.fastq Input file: SRR3207991_1.fastq trimmed: SRR3207991-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:50:33 2025 >> started Tue Feb 11 23:50:39 2025 >> done (5.955s) 13523090 reads processed; of these: 1186 ( 0.01%) short reads filtered out after trimming by size control 10366 ( 0.08%) empty reads filtered out after trimming by size control 13511538 (99.91%) reads available; of these: 565900 ( 4.19%) trimmed reads available after processing 12945638 (95.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 191 0.00% 19 282 0.00% 20 643 0.00% 21 509 0.00% 22 676 0.01% 23 1013 0.01% 24 1298 0.01% 25 1699 0.01% 26 1796 0.01% 27 1875 0.01% 28 1936 0.01% 29 1895 0.01% 30 1901 0.01% 31 1984 0.01% 32 2041 0.02% 33 2037 0.02% 34 2256 0.02% 35 2173 0.02% 36 2373 0.02% 37 2391 0.02% 38 2507 0.02% 39 2482 0.02% 40 2647 0.02% 41 2607 0.02% 42 2743 0.02% 43 2783 0.02% 44 2949 0.02% 45 2914 0.02% 46 2998 0.02% 47 3105 0.02% 48 3136 0.02% 49 3270 0.02% 50 3305 0.02% 51 3335 0.02% 52 3434 0.03% 53 3581 0.03% 54 3698 0.03% 55 3833 0.03% 56 3952 0.03% 57 3943 0.03% 58 4091 0.03% 59 4070 0.03% 60 4334 0.03% 61 4377 0.03% 62 4410 0.03% 63 4558 0.03% 64 4798 0.04% 65 4898 0.04% 66 5089 0.04% 67 5141 0.04% 68 5191 0.04% 69 5114 0.04% 70 5263 0.04% 71 5660 0.04% 72 5888 0.04% 73 5984 0.04% 74 6205 0.05% 75 6286 0.05% 76 4702 0.03% 77 5178 0.04% 78 5727 0.04% 79 6273 0.05% 80 6659 0.05% 81 6963 0.05% 82 7510 0.06% 83 7939 0.06% 84 8453 0.06% 85 8943 0.07% 86 9458 0.07% 87 10207 0.08% 88 11006 0.08% 89 12001 0.09% 90 13000 0.10% 91 14632 0.11% 92 16419 0.12% 93 18669 0.14% 94 21841 0.16% 95 25513 0.19% 96 29869 0.22% 97 35651 0.26% 98 41559 0.31% 99 52180 0.39% 100 12945638 95.81% 13511538 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=18.79 fanout-score-rank=25 prefix-density=0.14 prefix-fanout=18.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=340.90 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.5 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:50:54 Started mapping on | Feb 11 23:50:54 Finished on | Feb 11 23:51:09 Mapping speed, Million of reads per hour | 3242.77 Number of input reads | 13511538 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12917264 Uniquely mapped reads % | 95.60% Average mapped length | 98.84 Number of splices: Total | 3768198 Number of splices: Annotated (sjdb) | 3689654 Number of splices: GT/AG | 3706543 Number of splices: GC/AG | 50034 Number of splices: AT/AC | 3730 Number of splices: Non-canonical | 7891 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307563 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 76535 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 286711 286711 286711 N_multimapping 307563 307563 307563 N_noFeature 690418 6784719 6732149 N_ambiguous 142444 25629 26293 UnstrandedReadsAssigned:12084402 PositiveStrandReadsAssigned:6106916 NegativeStrandReadsAssigned:6158822 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207991 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207991-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,511,538 reads, 12,408,502 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,387 rounds 52401 SRR3207991.ke.tsv 34699 SRR3207991.se.tsv 87100 total ==> SRR3207991.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 581 35.9954 Potri.005G024800.1.v4.1 1035 936 119 15.1153 Potri.004G059700.1.v4.1 961 862 2 0.275847 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 247.325 10.3391 Potri.016G087400.1.v4.1 270 171 302 209.97 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 70 4.97151 Potri.012G127500.1.v4.1 977 878 1638 221.802 ==> SRR3207991.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1656 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 339 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR3207991 completed mapping pipeline successfully