Starting /dee2/code/volunteer_pipeline.sh SRR3207992 current disk space = 3052325371904 free memory = 1410432608 SRR3207992 SRAfilesize 261a502467ee9fd978f7469c0028bfc1 SRR3207992.sra SRR3207992.sra file validated SRR3207992 is single end SRR3207992 is conventional basespace SRR3207992 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.178 34.0 33.0 34.0 31.0 34.0 2 33.33625 34.0 34.0 34.0 31.0 34.0 3 33.39075 34.0 34.0 34.0 31.0 34.0 4 36.61325 37.0 37.0 37.0 35.0 37.0 5 36.5495 37.0 37.0 37.0 35.0 37.0 6 36.4755 37.0 37.0 37.0 35.0 37.0 7 36.47675 37.0 37.0 37.0 35.0 37.0 8 36.4395 37.0 37.0 37.0 35.0 37.0 9 38.26125 39.0 39.0 39.0 37.0 39.0 10-11 38.325125 39.0 39.0 39.0 37.0 39.0 12-13 38.443124999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.1495 41.0 40.0 41.0 38.0 41.0 16-17 39.994 41.0 40.0 41.0 38.0 41.0 18-19 39.911500000000004 41.0 40.0 41.0 38.0 41.0 20-21 40.007875 41.0 40.0 41.0 38.0 41.0 22-23 39.898875000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.86825 41.0 40.0 41.0 38.0 41.0 26-27 39.880125 41.0 40.0 41.0 38.0 41.0 28-29 39.775999999999996 41.0 40.0 41.0 38.0 41.0 30-31 39.63575 41.0 40.0 41.0 38.0 41.0 32-33 39.583375000000004 41.0 40.0 41.0 37.0 41.0 34-35 39.564499999999995 41.0 40.0 41.0 37.0 41.0 36-37 39.435375 41.0 40.0 41.0 37.0 41.0 38-39 39.416 41.0 40.0 41.0 37.0 41.0 40-41 39.342 41.0 39.5 41.0 36.5 41.0 42-43 39.24225 41.0 39.0 41.0 36.5 41.0 44-45 39.278 41.0 39.0 41.0 36.5 41.0 46-47 39.210375 41.0 39.0 41.0 36.0 41.0 48-49 39.079125000000005 41.0 39.0 41.0 36.0 41.0 50-51 39.255250000000004 41.0 39.0 41.0 36.0 41.0 52-53 39.275375 41.0 39.0 41.0 36.5 41.0 54-55 39.16125 41.0 39.0 41.0 36.0 41.0 56-57 38.63175 41.0 38.5 41.0 34.5 41.0 58-59 38.8545 41.0 39.0 41.0 35.0 41.0 60-61 38.671 40.0 38.0 41.0 35.0 41.0 62-63 38.547875 40.0 37.5 41.0 35.0 41.0 64-65 38.155125 40.0 37.0 41.0 35.0 41.0 66-67 37.87125 39.0 36.5 41.0 34.0 41.0 68-69 37.497875 39.0 36.0 41.0 34.0 41.0 70-71 37.071375 37.5 35.5 40.0 34.0 41.0 72-73 36.463750000000005 37.0 35.0 39.0 33.5 41.0 74-75 36.01775 37.0 35.0 39.0 33.0 40.5 76-77 35.03175 36.0 34.5 37.0 31.5 39.0 78-79 35.153999999999996 36.0 35.0 37.0 32.5 39.0 80-81 34.949625 35.0 35.0 37.0 33.0 39.0 82-83 34.608999999999995 35.0 35.0 36.5 33.0 37.0 84-85 34.33325 35.0 35.0 36.0 33.0 37.0 86-87 34.0655 35.0 35.0 36.0 32.5 37.0 88-89 33.799875 35.0 35.0 35.5 32.0 36.0 90-91 33.591375 35.0 35.0 35.0 31.5 36.0 92-93 33.565875000000005 35.0 35.0 35.0 32.0 36.0 94-95 33.509875 35.0 35.0 35.0 32.0 36.0 96-97 33.384125 35.0 34.5 35.0 32.0 35.5 98-99 33.267875000000004 35.0 34.0 35.0 32.0 36.0 100 33.0715 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 3.0 11 2.0 12 1.0 13 2.0 14 0.0 15 5.0 16 3.0 17 4.0 18 2.0 19 4.0 20 3.0 21 1.0 22 4.0 23 2.0 24 6.0 25 13.0 26 12.0 27 13.0 28 22.0 29 18.0 30 31.0 31 32.0 32 50.0 33 60.0 34 103.0 35 144.0 36 242.0 37 707.0 38 1859.0 39 649.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.074999999999996 15.325 11.700000000000001 47.9 2 18.6 22.45 38.0 20.95 3 21.6 25.624999999999996 25.924999999999997 26.85 4 25.05 30.45 20.424999999999997 24.075 5 25.55 33.175 23.275000000000002 18.0 6 18.099999999999998 38.675 24.0 19.225 7 18.425 20.150000000000002 42.225 19.2 8 19.175 23.825 32.15 24.85 9 20.65 23.1 32.5 23.75 10-11 22.3 33.7875 23.05 20.8625 12-13 20.3 26.887499999999996 29.9625 22.85 14-15 20.25 27.675 29.362500000000004 22.7125 16-17 21.3625 28.075 28.712500000000002 21.85 18-19 21.125 29.2375 27.537499999999998 22.1 20-21 21.8 28.462500000000002 28.000000000000004 21.7375 22-23 20.724999999999998 29.5 27.6625 22.112499999999997 24-25 21.373186593296648 28.76438219109555 27.788894447223612 22.07353676838419 26-27 21.2375 29.325000000000003 27.3375 22.1 28-29 21.43929912390488 28.623279098873596 27.997496871088863 21.939924906132667 30-31 21.675432006010517 28.863010267968946 27.998998246932132 21.462559479088405 32-33 21.775 28.462500000000002 28.1 21.6625 34-35 21.5625 29.2375 27.287499999999998 21.912499999999998 36-37 21.325 29.675 27.125 21.875 38-39 21.349999999999998 29.012500000000003 27.950000000000003 21.6875 40-41 21.675 28.675 28.4125 21.2375 42-43 21.462500000000002 28.6875 28.5875 21.2625 44-45 22.35 29.15 27.275 21.224999999999998 46-47 21.9625 28.549999999999997 27.6625 21.825 48-49 21.95 27.8625 28.6125 21.575 50-51 22.237499999999997 27.712500000000002 28.3875 21.6625 52-53 22.275 27.9375 27.9375 21.85 54-55 20.8 29.299999999999997 28.050000000000004 21.85 56-57 21.0625 29.037499999999998 28.6875 21.212500000000002 58-59 21.5 28.775000000000002 27.6875 22.037499999999998 60-61 21.775 28.6625 28.3875 21.175 62-63 21.8 28.95 27.775 21.475 64-65 21.224999999999998 29.575000000000003 27.737499999999997 21.462500000000002 66-67 21.4375 29.062500000000004 28.1875 21.3125 68-69 21.325 28.6625 28.499999999999996 21.512500000000003 70-71 21.45 29.262500000000003 27.750000000000004 21.5375 72-73 22.1 28.475 27.962500000000002 21.462500000000002 74-75 22.6125 27.6625 28.212500000000002 21.512500000000003 76-77 21.45 29.1375 28.1875 21.224999999999998 78-79 21.825 29.2875 27.2625 21.625 80-81 21.4125 28.225 28.799999999999997 21.5625 82-83 22.237499999999997 29.062500000000004 27.500000000000004 21.2 84-85 21.912499999999998 28.925 27.8875 21.275 86-87 22.15 28.287499999999998 28.287499999999998 21.275 88-89 21.8875 29.612500000000004 26.937499999999996 21.5625 90-91 21.875 27.6125 28.512500000000003 22.0 92-93 21.175 28.599999999999998 28.275 21.95 94-95 21.95 28.4 28.1875 21.462500000000002 96-97 22.412499999999998 27.8625 28.6375 21.087500000000002 98-99 22.1875 27.725 29.75 20.3375 100 21.975 29.7 27.425 20.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 2.0 25 4.0 26 5.0 27 4.0 28 6.0 29 13.0 30 17.5 31 30.5 32 47.0 33 48.0 34 62.5 35 93.0 36 102.5 37 117.5 38 147.0 39 182.0 40 219.0 41 246.0 42 259.5 43 268.5 44 276.5 45 266.5 46 263.0 47 240.0 48 203.5 49 180.0 50 157.5 51 125.0 52 95.0 53 79.0 54 61.5 55 43.5 56 25.0 57 21.5 58 20.5 59 14.0 60 11.0 61 8.0 62 6.0 63 5.5 64 4.5 65 3.0 66 1.5 67 2.0 68 2.5 69 1.5 70 0.5 71 1.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.05 26-27 0.0 28-29 0.125 30-31 0.17500000000000002 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867375 spots for SRR3207992.sra Written 867375 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra Read 867369 spots for SRR3207992.sra Written 867369 spots for SRR3207992.sra SRR ids: ['SRR3207992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p2iz_w68 SRR3207992.sra spots: 17347386 blocks: [[1, 867369], [867370, 1734738], [1734739, 2602107], [2602108, 3469476], [3469477, 4336845], [4336846, 5204214], [5204215, 6071583], [6071584, 6938952], [6938953, 7806321], [7806322, 8673690], [8673691, 9541059], [9541060, 10408428], [10408429, 11275797], [11275798, 12143166], [12143167, 13010535], [13010536, 13877904], [13877905, 14745273], [14745274, 15612642], [15612643, 16480011], [16480012, 17347386]] SRR3207992 file size 4503778 SRR3207992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207992 SRR3207992_1.fastq Input file: SRR3207992_1.fastq trimmed: SRR3207992-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:20:20 2025 >> started Tue Feb 11 23:20:31 2025 >> done (10.154s) 17347386 reads processed; of these: 1737 ( 0.01%) short reads filtered out after trimming by size control 10109 ( 0.06%) empty reads filtered out after trimming by size control 17335540 (99.93%) reads available; of these: 715599 ( 4.13%) trimmed reads available after processing 16619941 (95.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 282 0.00% 19 355 0.00% 20 454 0.00% 21 613 0.00% 22 911 0.01% 23 1208 0.01% 24 1694 0.01% 25 2127 0.01% 26 2270 0.01% 27 2377 0.01% 28 2216 0.01% 29 2299 0.01% 30 2351 0.01% 31 2438 0.01% 32 2533 0.01% 33 2566 0.01% 34 2822 0.02% 35 2771 0.02% 36 2876 0.02% 37 2899 0.02% 38 3009 0.02% 39 3232 0.02% 40 3164 0.02% 41 3356 0.02% 42 3460 0.02% 43 3533 0.02% 44 3628 0.02% 45 3756 0.02% 46 3793 0.02% 47 3897 0.02% 48 3908 0.02% 49 4124 0.02% 50 4093 0.02% 51 4090 0.02% 52 4277 0.02% 53 4558 0.03% 54 4649 0.03% 55 4692 0.03% 56 4869 0.03% 57 5007 0.03% 58 5081 0.03% 59 5126 0.03% 60 5490 0.03% 61 5533 0.03% 62 5637 0.03% 63 5799 0.03% 64 5947 0.03% 65 6176 0.04% 66 6306 0.04% 67 6311 0.04% 68 6744 0.04% 69 6474 0.04% 70 6801 0.04% 71 7252 0.04% 72 7595 0.04% 73 7753 0.04% 74 7939 0.05% 75 7980 0.05% 76 5862 0.03% 77 6508 0.04% 78 7389 0.04% 79 7713 0.04% 80 8482 0.05% 81 8970 0.05% 82 9457 0.05% 83 10210 0.06% 84 10674 0.06% 85 11250 0.06% 86 12174 0.07% 87 12780 0.07% 88 13977 0.08% 89 15227 0.09% 90 16733 0.10% 91 18906 0.11% 92 21002 0.12% 93 23621 0.14% 94 27951 0.16% 95 32256 0.19% 96 37684 0.22% 97 45383 0.26% 98 51977 0.30% 99 66312 0.38% 100 16619941 95.87% 17335540 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=14.94 fanout-score-rank=22 prefix-density=0.11 prefix-fanout=14.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=350.90 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=29.6 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:20:47 Started mapping on | Feb 11 23:20:47 Finished on | Feb 11 23:21:03 Mapping speed, Million of reads per hour | 3900.50 Number of input reads | 17335540 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 16676021 Uniquely mapped reads % | 96.20% Average mapped length | 98.84 Number of splices: Total | 4833451 Number of splices: Annotated (sjdb) | 4738980 Number of splices: GT/AG | 4756025 Number of splices: GC/AG | 62733 Number of splices: AT/AC | 4939 Number of splices: Non-canonical | 9754 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382871 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 68173 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 276648 276648 276648 N_multimapping 382871 382871 382871 N_noFeature 838548 8698536 8699580 N_ambiguous 176668 30034 30551 UnstrandedReadsAssigned:15660805 PositiveStrandReadsAssigned:7947451 NegativeStrandReadsAssigned:7945890 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207992 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207992-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,335,540 reads, 16,055,743 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,362 rounds 52401 SRR3207992.ke.tsv 34699 SRR3207992.se.tsv 87100 total ==> SRR3207992.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 492 23.556 Potri.005G024800.1.v4.1 1035 936 119 11.6811 Potri.004G059700.1.v4.1 961 862 11 1.17246 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 315.254 10.1846 Potri.016G087400.1.v4.1 270 171 507 272.411 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 70 3.84198 Potri.012G127500.1.v4.1 977 878 2095 219.231 ==> SRR3207992.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2127 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 335 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207992 completed mapping pipeline successfully