Starting /dee2/code/volunteer_pipeline.sh SRR3207993 current disk space = 3052133789696 free memory = 1505674824 SRR3207993 SRAfilesize 914522ee22c077b5c28e1a4b13a400d5 SRR3207993.sra SRR3207993.sra file validated SRR3207993 is single end SRR3207993 is conventional basespace SRR3207993 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.058 34.0 33.0 34.0 31.0 34.0 2 33.277 34.0 34.0 34.0 31.0 34.0 3 33.31175 34.0 34.0 34.0 31.0 34.0 4 36.57575 37.0 37.0 37.0 35.0 37.0 5 36.5415 37.0 37.0 37.0 35.0 37.0 6 36.41525 37.0 37.0 37.0 35.0 37.0 7 36.469 37.0 37.0 37.0 35.0 37.0 8 36.3715 37.0 37.0 37.0 35.0 37.0 9 38.208 39.0 39.0 39.0 37.0 39.0 10-11 38.272 39.0 39.0 39.0 37.0 39.0 12-13 38.361374999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.00125 41.0 40.0 41.0 38.0 41.0 16-17 39.894625 41.0 40.0 41.0 38.0 41.0 18-19 39.86425 41.0 40.0 41.0 38.0 41.0 20-21 39.938125 41.0 40.0 41.0 38.0 41.0 22-23 39.783 41.0 40.0 41.0 38.0 41.0 24-25 39.738125 41.0 40.0 41.0 38.0 41.0 26-27 39.793875 41.0 40.0 41.0 38.0 41.0 28-29 39.70775 41.0 40.0 41.0 38.0 41.0 30-31 39.53875 41.0 40.0 41.0 38.0 41.0 32-33 39.476625 41.0 40.0 41.0 37.0 41.0 34-35 39.487875 41.0 40.0 41.0 37.0 41.0 36-37 39.39275000000001 41.0 40.0 41.0 37.0 41.0 38-39 39.33625 41.0 40.0 41.0 37.0 41.0 40-41 39.19725 41.0 39.0 41.0 36.0 41.0 42-43 39.113625 41.0 39.0 41.0 36.0 41.0 44-45 39.167875 41.0 39.0 41.0 36.5 41.0 46-47 39.08525 41.0 39.0 41.0 36.0 41.0 48-49 39.009249999999994 41.0 39.0 41.0 35.5 41.0 50-51 39.133875 41.0 39.0 41.0 36.0 41.0 52-53 39.160375 41.0 39.0 41.0 36.0 41.0 54-55 39.051375 41.0 39.0 41.0 35.0 41.0 56-57 38.52225 41.0 38.5 41.0 34.5 41.0 58-59 38.609 41.0 38.5 41.0 35.0 41.0 60-61 38.464875 40.0 38.0 41.0 35.0 41.0 62-63 38.369625 40.0 37.0 41.0 35.0 41.0 64-65 38.01475 39.5 37.0 41.0 34.0 41.0 66-67 37.589749999999995 39.0 36.0 41.0 34.0 41.0 68-69 37.311875 39.0 36.0 41.0 34.0 41.0 70-71 36.828875 37.5 35.0 40.0 34.0 41.0 72-73 36.14925 37.0 35.0 39.0 33.0 41.0 74-75 35.770125 36.5 35.0 39.0 33.0 40.5 76-77 34.80075 36.0 34.5 37.0 31.0 39.0 78-79 34.92825 36.0 35.0 37.0 32.0 39.0 80-81 34.78425 35.0 35.0 37.0 33.0 39.0 82-83 34.436625 35.0 35.0 36.5 32.5 37.0 84-85 34.174 35.0 35.0 36.0 32.0 37.0 86-87 33.909875 35.0 35.0 36.0 32.0 37.0 88-89 33.686499999999995 35.0 35.0 35.0 32.0 36.0 90-91 33.485625 35.0 34.5 35.0 31.5 36.0 92-93 33.442125000000004 35.0 34.5 35.0 31.5 36.0 94-95 33.36475 35.0 34.5 35.0 31.5 36.0 96-97 33.285875 35.0 34.0 35.0 31.0 35.5 98-99 33.154250000000005 35.0 34.0 35.0 31.5 35.0 100 33.0425 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 3.0 9 4.0 10 5.0 11 3.0 12 2.0 13 4.0 14 2.0 15 2.0 16 2.0 17 0.0 18 2.0 19 4.0 20 5.0 21 3.0 22 5.0 23 3.0 24 12.0 25 9.0 26 8.0 27 18.0 28 25.0 29 23.0 30 30.0 31 31.0 32 46.0 33 71.0 34 95.0 35 156.0 36 252.0 37 717.0 38 1844.0 39 610.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.6 17.125 13.750000000000002 44.525 2 18.95 24.224999999999998 38.2 18.625 3 20.424999999999997 28.299999999999997 28.675 22.6 4 23.025000000000002 33.175 21.425 22.375 5 23.974999999999998 36.5 21.55 17.974999999999998 6 18.65 36.225 25.324999999999996 19.8 7 16.55 19.15 43.0 21.3 8 19.775000000000002 22.8 30.25 27.175 9 20.75 23.025000000000002 30.975 25.25 10-11 22.325 32.8375 22.9625 21.875 12-13 20.225 26.487500000000004 29.612500000000004 23.674999999999997 14-15 20.45 27.6 29.462500000000002 22.4875 16-17 21.637500000000003 27.8875 28.025 22.45 18-19 21.8 27.787499999999998 28.1125 22.3 20-21 21.1875 29.049999999999997 27.9375 21.825 22-23 21.43035758939735 29.94498624656164 27.094273568392097 21.530382595648913 24-25 21.47592245153221 28.367729831144466 27.842401500938085 22.31394621638524 26-27 21.5 28.262500000000003 27.400000000000002 22.8375 28-29 21.547514711406034 28.57142857142857 28.120696131213226 21.76036058595217 30-31 20.66675021932573 29.02619375861637 27.346785311442535 22.960270710615365 32-33 21.25 29.1125 27.35 22.287499999999998 34-35 21.1625 28.349999999999998 27.9125 22.575 36-37 21.375 29.15 27.3625 22.112499999999997 38-39 21.2875 29.2375 28.212500000000002 21.2625 40-41 21.2 28.4375 27.437499999999996 22.925 42-43 22.412499999999998 27.6125 28.65 21.325 44-45 21.625 28.262500000000003 28.199999999999996 21.912499999999998 46-47 22.275 27.5125 27.55 22.662499999999998 48-49 21.4125 28.962500000000002 27.737499999999997 21.8875 50-51 22.225 27.900000000000002 28.449999999999996 21.425 52-53 21.6 28.15 28.0875 22.162499999999998 54-55 21.1875 28.5625 27.85 22.400000000000002 56-57 21.3625 29.2875 27.5875 21.762500000000003 58-59 21.325 27.825 28.199999999999996 22.650000000000002 60-61 21.525 28.762500000000003 28.462500000000002 21.25 62-63 22.5625 27.250000000000004 28.512500000000003 21.675 64-65 21.712500000000002 28.175 28.799999999999997 21.3125 66-67 22.400000000000002 27.650000000000002 28.299999999999997 21.65 68-69 22.2125 27.675 29.2 20.9125 70-71 22.237499999999997 29.062500000000004 26.450000000000003 22.25 72-73 21.837500000000002 29.4375 27.3625 21.3625 74-75 21.712500000000002 28.499999999999996 27.0875 22.7 76-77 21.725 28.875 28.0875 21.3125 78-79 21.4875 28.6125 28.000000000000004 21.9 80-81 20.8625 29.25 27.800000000000004 22.0875 82-83 22.4875 27.950000000000003 27.962500000000002 21.6 84-85 21.3625 27.462500000000002 29.3875 21.7875 86-87 21.45 28.025 28.875 21.65 88-89 21.6 29.15 27.4125 21.837500000000002 90-91 22.4375 28.287499999999998 27.5875 21.6875 92-93 21.925 29.099999999999998 27.250000000000004 21.725 94-95 21.725 29.2375 27.1375 21.9 96-97 22.275 28.0625 27.6 22.0625 98-99 21.9 27.787499999999998 27.8125 22.5 100 22.95 28.375 27.3 21.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.0 24 4.0 25 6.0 26 8.0 27 10.0 28 11.5 29 13.5 30 19.0 31 31.0 32 38.0 33 44.0 34 61.0 35 77.0 36 87.0 37 110.5 38 149.0 39 176.0 40 194.0 41 214.5 42 247.0 43 282.0 44 279.5 45 258.0 46 244.5 47 234.0 48 220.5 49 194.0 50 168.5 51 147.0 52 117.5 53 88.0 54 60.0 55 46.0 56 42.0 57 28.5 58 16.0 59 11.0 60 9.0 61 7.5 62 6.5 63 5.0 64 4.5 65 3.5 66 4.5 67 4.5 68 1.5 69 1.5 70 2.0 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.025 24-25 0.0625 26-27 0.0 28-29 0.1625 30-31 0.2625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77375565610859 99.225 2 0.17596782302664657 0.35000000000000003 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.26249999999999996 0.0 0.0 0.0 0.0 22-23 0.35 0.0 0.0 0.0 0.0 24-25 0.35 0.0 0.0 0.0 0.0 26-27 0.35 0.0 0.0 0.0 0.0 28-29 0.35 0.0 0.0 0.0 0.0 30-31 0.35 0.0 0.0 0.0 0.0 32-33 0.35 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.3875 0.0 0.0 0.0 0.0 38-39 0.4 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.4 0.0 0.0 0.0 0.0 50-51 0.4 0.0 0.0 0.0 0.0 52-53 0.4 0.0 0.0 0.0 0.0 54-55 0.4125 0.0 0.0 0.0 0.0 56-57 0.425 0.0 0.0 0.0 0.0 58-59 0.425 0.0 0.0 0.0 0.0 60-61 0.425 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.4875 0.0 0.0 0.0 0.0 66-67 0.5 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.525 0.0 0.0 0.0 0.0 72-73 0.5375000000000001 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665895 spots for SRR3207993.sra Written 665895 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra Read 665882 spots for SRR3207993.sra Written 665882 spots for SRR3207993.sra SRR ids: ['SRR3207993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_app06hr7 SRR3207993.sra spots: 13317653 blocks: [[1, 665882], [665883, 1331764], [1331765, 1997646], [1997647, 2663528], [2663529, 3329410], [3329411, 3995292], [3995293, 4661174], [4661175, 5327056], [5327057, 5992938], [5992939, 6658820], [6658821, 7324702], [7324703, 7990584], [7990585, 8656466], [8656467, 9322348], [9322349, 9988230], [9988231, 10654112], [10654113, 11319994], [11319995, 11985876], [11985877, 12651758], [12651759, 13317653]] SRR3207993 file size 3455050 SRR3207993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207993 SRR3207993_1.fastq Input file: SRR3207993_1.fastq trimmed: SRR3207993-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:36:34 2025 >> started Tue Feb 11 23:36:41 2025 >> done (6.924s) 13317653 reads processed; of these: 2794 ( 0.02%) short reads filtered out after trimming by size control 76208 ( 0.57%) empty reads filtered out after trimming by size control 13238651 (99.41%) reads available; of these: 588259 ( 4.44%) trimmed reads available after processing 12650392 (95.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 486 0.00% 19 4129 0.03% 20 13688 0.10% 21 1001 0.01% 22 896 0.01% 23 1205 0.01% 24 1750 0.01% 25 2125 0.02% 26 2273 0.02% 27 2086 0.02% 28 2404 0.02% 29 2532 0.02% 30 2015 0.02% 31 3746 0.03% 32 2675 0.02% 33 2963 0.02% 34 2606 0.02% 35 2263 0.02% 36 3748 0.03% 37 2776 0.02% 38 2753 0.02% 39 3655 0.03% 40 3231 0.02% 41 3298 0.02% 42 3081 0.02% 43 3047 0.02% 44 3226 0.02% 45 3143 0.02% 46 3263 0.02% 47 3224 0.02% 48 3702 0.03% 49 3579 0.03% 50 3527 0.03% 51 3552 0.03% 52 3894 0.03% 53 3813 0.03% 54 3892 0.03% 55 3787 0.03% 56 4091 0.03% 57 4416 0.03% 58 4398 0.03% 59 4455 0.03% 60 4893 0.04% 61 4928 0.04% 62 4734 0.04% 63 4861 0.04% 64 5157 0.04% 65 6245 0.05% 66 5509 0.04% 67 6043 0.05% 68 5814 0.04% 69 5186 0.04% 70 6021 0.05% 71 6312 0.05% 72 6198 0.05% 73 6296 0.05% 74 6120 0.05% 75 6119 0.05% 76 4465 0.03% 77 4963 0.04% 78 5434 0.04% 79 5933 0.04% 80 6445 0.05% 81 6648 0.05% 82 7161 0.05% 83 8055 0.06% 84 8170 0.06% 85 8522 0.06% 86 8882 0.07% 87 9573 0.07% 88 10347 0.08% 89 11470 0.09% 90 12646 0.10% 91 14172 0.11% 92 15793 0.12% 93 17644 0.13% 94 20829 0.16% 95 23673 0.18% 96 28378 0.21% 97 33714 0.25% 98 38659 0.29% 99 49853 0.38% 100 12650392 95.56% 13238651 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=45.79 fanout-score-rank=14 prefix-density=0.44 prefix-fanout=33.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=308.53 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.3 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:37:00 Started mapping on | Feb 11 23:37:01 Finished on | Feb 11 23:37:16 Mapping speed, Million of reads per hour | 3177.28 Number of input reads | 13238651 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 12593960 Uniquely mapped reads % | 95.13% Average mapped length | 98.86 Number of splices: Total | 3685903 Number of splices: Annotated (sjdb) | 3614633 Number of splices: GT/AG | 3627574 Number of splices: GC/AG | 47720 Number of splices: AT/AC | 3754 Number of splices: Non-canonical | 6855 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309599 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 102736 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 335092 335092 335092 N_multimapping 309599 309599 309599 N_noFeature 653916 6546031 6616100 N_ambiguous 129650 21951 22204 UnstrandedReadsAssigned:11810394 PositiveStrandReadsAssigned:6025978 NegativeStrandReadsAssigned:5955656 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207993 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207993-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,238,651 reads, 12,137,327 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR3207993.ke.tsv 34699 SRR3207993.se.tsv 87100 total ==> SRR3207993.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 356 22.7121 Potri.005G024800.1.v4.1 1035 936 52 6.80159 Potri.004G059700.1.v4.1 961 862 13 1.84637 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 222.372 9.57267 Potri.016G087400.1.v4.1 270 171 438 313.589 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 55 4.02244 Potri.012G127500.1.v4.1 977 878 1914 266.889 ==> SRR3207993.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1346 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR3207993 completed mapping pipeline successfully