Starting /dee2/code/volunteer_pipeline.sh SRR3207994 current disk space = 3052087676928 free memory = 1517989536 SRR3207994 SRAfilesize 44293ec6a8c8fb8d7d15a68df8ec838e SRR3207994.sra SRR3207994.sra file validated SRR3207994 is single end SRR3207994 is conventional basespace SRR3207994 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.158 34.0 33.0 34.0 31.0 34.0 2 33.29 34.0 34.0 34.0 31.0 34.0 3 33.30925 34.0 34.0 34.0 31.0 34.0 4 36.639 37.0 37.0 37.0 35.0 37.0 5 36.55575 37.0 37.0 37.0 35.0 37.0 6 36.4805 37.0 37.0 37.0 35.0 37.0 7 36.4555 37.0 37.0 37.0 35.0 37.0 8 36.51725 37.0 37.0 37.0 35.0 37.0 9 38.36925 39.0 39.0 39.0 37.0 39.0 10-11 38.407 39.0 39.0 39.0 37.0 39.0 12-13 38.349000000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.884375 41.0 40.0 41.0 38.0 41.0 16-17 39.922625 41.0 40.0 41.0 38.0 41.0 18-19 39.921125 41.0 40.0 41.0 38.0 41.0 20-21 39.879000000000005 41.0 40.0 41.0 38.0 41.0 22-23 39.8435 41.0 40.0 41.0 38.0 41.0 24-25 39.7195 41.0 40.0 41.0 37.5 41.0 26-27 39.680875 41.0 40.0 41.0 37.0 41.0 28-29 39.53475 41.0 40.0 41.0 37.0 41.0 30-31 39.309 41.0 40.0 41.0 36.5 41.0 32-33 39.283 41.0 39.5 41.0 37.0 41.0 34-35 38.91975 41.0 39.0 41.0 35.5 41.0 36-37 38.94825 41.0 39.0 41.0 35.0 41.0 38-39 38.90325 40.5 39.0 41.0 35.5 41.0 40-41 38.84525 40.0 39.0 41.0 35.0 41.0 42-43 38.71575 40.0 38.5 41.0 35.0 41.0 44-45 38.6255 40.0 38.0 41.0 35.0 41.0 46-47 38.516000000000005 40.0 38.0 41.0 35.0 41.0 48-49 38.430875 40.0 38.0 41.0 34.0 41.0 50-51 38.644625 40.5 39.0 41.0 35.0 41.0 52-53 38.573499999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.396625 41.0 38.5 41.0 34.5 41.0 56-57 38.280625 40.0 38.0 41.0 34.0 41.0 58-59 38.01875 40.0 37.5 41.0 34.0 41.0 60-61 37.857875 40.0 37.0 41.0 34.0 41.0 62-63 37.480625 39.5 36.5 41.0 33.5 41.0 64-65 37.2185 39.0 36.0 41.0 33.5 41.0 66-67 36.744125 39.0 35.0 41.0 32.5 41.0 68-69 36.376374999999996 37.5 35.0 40.5 32.0 41.0 70-71 35.914125 37.0 35.0 39.5 32.0 41.0 72-73 35.364999999999995 36.5 35.0 39.0 31.0 41.0 74-75 35.050125 36.0 35.0 39.0 31.0 40.0 76-77 33.85825 35.0 34.0 37.0 29.5 39.0 78-79 34.089 35.0 34.5 37.0 30.5 39.0 80-81 33.814875 35.0 34.5 36.5 30.0 38.0 82-83 33.488125 35.0 34.0 36.0 30.0 37.0 84-85 33.099500000000006 35.0 34.0 36.0 29.0 37.0 86-87 32.899375000000006 35.0 34.0 35.0 29.0 36.0 88-89 32.76025 35.0 34.0 35.0 29.0 36.0 90-91 32.5865 35.0 34.0 35.0 29.0 36.0 92-93 32.418375 35.0 34.0 35.0 29.0 36.0 94-95 32.226625 35.0 34.0 35.0 28.5 35.0 96-97 32.196875000000006 35.0 34.0 35.0 28.5 35.0 98-99 31.948500000000003 35.0 34.0 35.0 28.0 35.0 100 31.83475 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 10.0 11 3.0 12 7.0 13 3.0 14 2.0 15 4.0 16 3.0 17 10.0 18 9.0 19 10.0 20 7.0 21 11.0 22 16.0 23 9.0 24 12.0 25 11.0 26 15.0 27 20.0 28 25.0 29 27.0 30 39.0 31 53.0 32 51.0 33 85.0 34 107.0 35 168.0 36 338.0 37 838.0 38 1643.0 39 459.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.124999999999996 14.124999999999998 14.725 46.025 2 20.275000000000002 21.3 35.25 23.175 3 22.825 25.85 26.275 25.05 4 25.025 30.525000000000002 19.45 25.0 5 25.174999999999997 33.5 22.625 18.7 6 19.175 36.55 23.674999999999997 20.599999999999998 7 17.0 18.95 43.175000000000004 20.875 8 18.25 22.5 31.05 28.199999999999996 9 21.099999999999998 21.8 31.974999999999998 25.124999999999996 10-11 22.45 32.85 22.475 22.225 12-13 20.724999999999998 26.5375 30.025000000000002 22.7125 14-15 21.7875 27.787499999999998 28.1625 22.2625 16-17 22.3375 28.349999999999998 27.3 22.0125 18-19 22.2625 28.225 27.250000000000004 22.2625 20-21 22.7125 27.525 27.287499999999998 22.475 22-23 22.9625 27.525 26.8 22.7125 24-25 21.970739027135174 28.135550831561833 27.697886707515316 22.19582343378767 26-27 22.325 28.299999999999997 27.075 22.3 28-29 22.61815453863466 28.319579894973746 26.906726681670417 22.155538884721178 30-31 21.917636750531983 27.55038177494054 26.874452372011515 23.65752910251596 32-33 22.15 28.499999999999996 27.212500000000002 22.1375 34-35 22.35 27.875 26.2875 23.4875 36-37 21.65 27.400000000000002 28.000000000000004 22.95 38-39 23.474999999999998 28.0625 26.125 22.3375 40-41 22.25 27.8625 26.8375 23.05 42-43 21.875 29.175 26.900000000000002 22.05 44-45 22.112499999999997 28.487499999999997 26.8375 22.5625 46-47 22.900000000000002 27.55 26.737499999999997 22.8125 48-49 22.7375 27.787499999999998 26.5125 22.9625 50-51 23.0 28.075 26.75 22.175 52-53 22.55 27.950000000000003 26.875 22.625 54-55 22.287499999999998 28.175 27.437499999999996 22.1 56-57 21.837500000000002 28.712500000000002 27.4125 22.037499999999998 58-59 22.25 27.8375 27.35 22.5625 60-61 22.35 27.125 27.5875 22.9375 62-63 22.275 27.962500000000002 27.6 22.162499999999998 64-65 22.525000000000002 28.299999999999997 26.487500000000004 22.6875 66-67 22.325 27.55 27.1375 22.9875 68-69 22.625 27.437499999999996 26.937499999999996 23.0 70-71 22.9375 26.4625 27.925 22.675 72-73 22.725 27.187499999999996 27.712500000000002 22.375 74-75 22.2625 27.1 27.4125 23.225 76-77 22.475 28.025 26.875 22.625 78-79 23.0625 27.325 26.875 22.7375 80-81 22.775000000000002 27.025 27.575 22.625 82-83 22.8625 27.650000000000002 27.150000000000002 22.3375 84-85 22.8375 27.700000000000003 27.0875 22.375 86-87 22.7 26.875 27.875 22.55 88-89 23.3625 27.3375 26.687499999999996 22.6125 90-91 21.975 27.675 28.1625 22.1875 92-93 22.237499999999997 27.5625 27.750000000000004 22.45 94-95 22.9875 27.1625 26.937499999999996 22.912499999999998 96-97 22.3875 27.575 27.474999999999998 22.5625 98-99 22.3 27.712500000000002 27.900000000000002 22.0875 100 24.025 26.85 27.224999999999998 21.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 4.0 27 5.0 28 4.0 29 4.5 30 8.0 31 18.0 32 24.0 33 31.0 34 46.0 35 57.5 36 68.0 37 90.0 38 125.5 39 149.5 40 177.0 41 206.0 42 225.0 43 261.5 44 277.0 45 281.5 46 280.0 47 258.5 48 231.0 49 199.0 50 175.5 51 148.0 52 122.0 53 104.0 54 81.5 55 57.0 56 42.5 57 37.0 58 36.5 59 32.0 60 20.5 61 12.0 62 12.0 63 12.0 64 9.5 65 10.5 66 9.5 67 5.5 68 3.5 69 2.5 70 2.0 71 3.5 72 3.0 73 2.5 74 2.5 75 2.5 76 3.5 77 3.0 78 3.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.025 30-31 0.13749999999999998 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.037500000000000006 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767040 spots for SRR3207994.sra Written 767040 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra Read 767027 spots for SRR3207994.sra Written 767027 spots for SRR3207994.sra SRR ids: ['SRR3207994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhx_kk4g SRR3207994.sra spots: 15340553 blocks: [[1, 767027], [767028, 1534054], [1534055, 2301081], [2301082, 3068108], [3068109, 3835135], [3835136, 4602162], [4602163, 5369189], [5369190, 6136216], [6136217, 6903243], [6903244, 7670270], [7670271, 8437297], [8437298, 9204324], [9204325, 9971351], [9971352, 10738378], [10738379, 11505405], [11505406, 12272432], [12272433, 13039459], [13039460, 13806486], [13806487, 14573513], [14573514, 15340553]] SRR3207994 file size 3981524 SRR3207994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207994 SRR3207994_1.fastq Input file: SRR3207994_1.fastq trimmed: SRR3207994-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:39:11 2025 >> started Tue Feb 11 23:39:22 2025 >> done (10.724s) 15340553 reads processed; of these: 2627 ( 0.02%) short reads filtered out after trimming by size control 10608 ( 0.07%) empty reads filtered out after trimming by size control 15327318 (99.91%) reads available; of these: 740706 ( 4.83%) trimmed reads available after processing 14586612 (95.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 378 0.00% 19 452 0.00% 20 512 0.00% 21 612 0.00% 22 990 0.01% 23 1419 0.01% 24 1920 0.01% 25 2371 0.02% 26 2697 0.02% 27 2385 0.02% 28 2276 0.01% 29 2285 0.01% 30 2339 0.02% 31 2381 0.02% 32 2647 0.02% 33 2479 0.02% 34 2689 0.02% 35 2708 0.02% 36 2845 0.02% 37 2936 0.02% 38 3098 0.02% 39 3120 0.02% 40 3289 0.02% 41 3590 0.02% 42 3849 0.03% 43 3943 0.03% 44 3986 0.03% 45 3914 0.03% 46 3933 0.03% 47 3945 0.03% 48 3940 0.03% 49 4097 0.03% 50 3922 0.03% 51 4215 0.03% 52 4093 0.03% 53 4395 0.03% 54 4449 0.03% 55 4528 0.03% 56 4850 0.03% 57 4915 0.03% 58 5246 0.03% 59 5239 0.03% 60 5370 0.04% 61 5672 0.04% 62 5749 0.04% 63 5684 0.04% 64 5756 0.04% 65 6068 0.04% 66 6252 0.04% 67 6448 0.04% 68 6595 0.04% 69 6857 0.04% 70 7237 0.05% 71 7610 0.05% 72 7979 0.05% 73 8080 0.05% 74 8287 0.05% 75 8491 0.06% 76 5917 0.04% 77 6654 0.04% 78 7610 0.05% 79 8160 0.05% 80 8681 0.06% 81 9381 0.06% 82 10256 0.07% 83 10836 0.07% 84 11457 0.07% 85 11985 0.08% 86 12833 0.08% 87 13857 0.09% 88 14950 0.10% 89 16439 0.11% 90 17753 0.12% 91 20106 0.13% 92 22742 0.15% 93 25619 0.17% 94 30111 0.20% 95 35044 0.23% 96 41277 0.27% 97 49831 0.33% 98 53869 0.35% 99 57326 0.37% 100 14586612 95.17% 15327318 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=25 prefix-density=0.14 prefix-fanout=2.5 sequence=TTCAACCAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTGTCTACTATCCAGCGAAACCACAGCCAAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAGAGGTGTAGGATAAGTGGGAGCTTCGGCGAAGGTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGTGTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAAAAGGGTAAAAGCTCGTTTGATTCTGATTTCCAGTACGAATAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=152.58 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=21.5 sequence=AAGAAGAAGAAA Started job on | Feb 11 23:39:38 Started mapping on | Feb 11 23:39:39 Finished on | Feb 11 23:39:58 Mapping speed, Million of reads per hour | 2904.12 Number of input reads | 15327318 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13856301 Uniquely mapped reads % | 90.40% Average mapped length | 99.03 Number of splices: Total | 4234216 Number of splices: Annotated (sjdb) | 4161552 Number of splices: GT/AG | 4172034 Number of splices: GC/AG | 52365 Number of splices: AT/AC | 4324 Number of splices: Non-canonical | 5493 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343658 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 1029687 % of reads mapped to too many loci | 6.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1127359 1127359 1127359 N_multimapping 343658 343658 343658 N_noFeature 509820 7086300 7178981 N_ambiguous 146612 22997 22972 UnstrandedReadsAssigned:13199869 PositiveStrandReadsAssigned:6747004 NegativeStrandReadsAssigned:6654348 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207994 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207994-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,327,318 reads, 14,366,435 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR3207994.ke.tsv 34699 SRR3207994.se.tsv 87100 total ==> SRR3207994.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 445 23.6029 Potri.005G024800.1.v4.1 1035 936 57 6.1984 Potri.004G059700.1.v4.1 961 862 22 2.59774 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 218.243 7.81072 Potri.016G087400.1.v4.1 270 171 428 254.758 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 54 3.28336 Potri.012G127500.1.v4.1 977 878 1299 150.59 ==> SRR3207994.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1590 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 48 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207994 completed mapping pipeline successfully