Starting /dee2/code/volunteer_pipeline.sh SRR3207995 current disk space = 3052278177792 free memory = 1481680488 SRR3207995 SRAfilesize e3b891d3b4be5f3f73f57513ea1b43ba SRR3207995.sra SRR3207995.sra file validated SRR3207995 is single end SRR3207995 is conventional basespace SRR3207995 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16525 34.0 33.0 34.0 31.0 34.0 2 33.30425 34.0 34.0 34.0 31.0 34.0 3 33.357 34.0 34.0 34.0 31.0 34.0 4 36.62425 37.0 37.0 37.0 35.0 37.0 5 36.55475 37.0 37.0 37.0 35.0 37.0 6 36.52525 37.0 37.0 37.0 35.0 37.0 7 36.53525 37.0 37.0 37.0 35.0 37.0 8 36.46825 37.0 37.0 37.0 35.0 37.0 9 38.3375 39.0 39.0 39.0 37.0 39.0 10-11 38.393 39.0 39.0 39.0 37.0 39.0 12-13 38.370125 39.0 39.0 39.0 37.0 39.0 14-15 39.85475 41.0 40.0 41.0 38.0 41.0 16-17 39.98975 41.0 40.0 41.0 38.0 41.0 18-19 39.961 41.0 40.0 41.0 38.0 41.0 20-21 39.9345 41.0 40.0 41.0 38.0 41.0 22-23 39.8885 41.0 40.0 41.0 38.0 41.0 24-25 39.8585 41.0 40.0 41.0 38.0 41.0 26-27 39.765375000000006 41.0 40.0 41.0 38.0 41.0 28-29 39.66975 41.0 40.0 41.0 37.5 41.0 30-31 39.495999999999995 41.0 40.0 41.0 37.0 41.0 32-33 39.416250000000005 41.0 40.0 41.0 37.0 41.0 34-35 39.110375000000005 41.0 39.0 41.0 36.0 41.0 36-37 39.20825 41.0 39.0 41.0 36.0 41.0 38-39 39.119 41.0 39.0 41.0 36.0 41.0 40-41 39.04325 40.0 39.0 41.0 35.5 41.0 42-43 38.882000000000005 40.0 39.0 41.0 35.0 41.0 44-45 38.75 40.0 38.0 41.0 35.0 41.0 46-47 38.794875000000005 40.0 38.5 41.0 35.0 41.0 48-49 38.663624999999996 40.0 38.0 41.0 35.0 41.0 50-51 38.786375 41.0 39.0 41.0 35.0 41.0 52-53 38.842625 41.0 39.0 41.0 35.0 41.0 54-55 38.725125000000006 41.0 38.5 41.0 35.0 41.0 56-57 38.543875 40.0 38.0 41.0 34.5 41.0 58-59 38.323 40.0 38.0 41.0 34.0 41.0 60-61 38.139375 40.0 37.0 41.0 34.0 41.0 62-63 37.85725 40.0 37.0 41.0 34.0 41.0 64-65 37.550625 39.0 36.0 41.0 34.0 41.0 66-67 37.085375 39.0 35.5 41.0 33.0 41.0 68-69 36.7415 38.5 35.0 40.5 33.0 41.0 70-71 36.263 37.0 35.0 39.5 32.0 41.0 72-73 35.681375 37.0 35.0 39.0 31.5 41.0 74-75 35.3405 36.0 35.0 39.0 32.0 40.5 76-77 34.147125 35.0 34.0 37.0 30.0 39.0 78-79 34.315124999999995 35.0 34.5 37.0 30.5 39.0 80-81 34.11175 35.0 35.0 37.0 31.0 38.0 82-83 33.662625 35.0 34.0 36.0 30.5 37.0 84-85 33.3115 35.0 34.0 36.0 30.0 37.0 86-87 33.167874999999995 35.0 34.0 35.0 30.0 36.5 88-89 33.018875 35.0 34.0 35.0 29.5 36.0 90-91 32.786500000000004 35.0 34.0 35.0 29.0 36.0 92-93 32.621625 35.0 34.0 35.0 29.0 36.0 94-95 32.42725 35.0 34.0 35.0 29.0 35.5 96-97 32.335375 35.0 34.0 35.0 29.0 35.0 98-99 32.197625 35.0 34.0 35.0 28.5 35.0 100 32.127 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 4.0 11 3.0 12 1.0 13 5.0 14 2.0 15 5.0 16 4.0 17 7.0 18 5.0 19 10.0 20 8.0 21 6.0 22 5.0 23 3.0 24 12.0 25 12.0 26 19.0 27 20.0 28 27.0 29 34.0 30 45.0 31 32.0 32 76.0 33 68.0 34 96.0 35 185.0 36 335.0 37 791.0 38 1682.0 39 496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.325 13.975000000000001 14.374999999999998 47.325 2 19.925 21.5 36.5 22.075 3 21.825 24.9 27.325 25.95 4 24.175 30.825000000000003 21.325 23.674999999999997 5 23.974999999999998 34.525 22.900000000000002 18.6 6 19.0 36.575 23.7 20.724999999999998 7 16.5 19.0 43.775 20.724999999999998 8 19.325 24.075 30.725 25.874999999999996 9 20.3 22.425 33.0 24.275 10-11 22.475 34.0125 22.287499999999998 21.224999999999998 12-13 20.375 26.5875 29.6875 23.35 14-15 21.2 27.787499999999998 28.7375 22.275 16-17 21.45 28.975 27.1 22.475 18-19 21.975 27.975 27.287499999999998 22.7625 20-21 21.625 27.975 27.4125 22.9875 22-23 22.5625 27.962500000000002 26.8 22.675 24-25 21.2375 28.875 27.325 22.5625 26-27 21.175 27.250000000000004 28.1375 23.4375 28-29 21.93322495935976 28.048018006752535 27.260222583468803 22.758534450418907 30-31 22.11093026167522 28.2458995868286 27.26931263302867 22.37385751846751 32-33 21.1125 28.0875 27.5625 23.2375 34-35 22.15 28.050000000000004 27.1 22.7 36-37 21.9625 27.450000000000003 27.3875 23.200000000000003 38-39 21.075 28.575 27.762500000000003 22.5875 40-41 22.5 28.275 26.950000000000003 22.275 42-43 22.112499999999997 28.462500000000002 27.275 22.15 44-45 22.1 28.3625 26.8625 22.675 46-47 22.125 26.875 28.037499999999998 22.9625 48-49 22.4625 28.050000000000004 26.687499999999996 22.8 50-51 21.7 28.849999999999998 27.1 22.35 52-53 22.3625 28.512500000000003 26.875 22.25 54-55 21.5625 28.3875 27.6 22.45 56-57 21.65 27.650000000000002 27.55 23.150000000000002 58-59 21.8 28.95 26.775 22.475 60-61 22.0875 28.4125 27.3375 22.162499999999998 62-63 21.6875 27.437499999999996 28.1375 22.7375 64-65 22.05 27.55 28.237499999999997 22.162499999999998 66-67 22.25 28.349999999999998 27.037499999999998 22.3625 68-69 22.4375 28.225 26.900000000000002 22.4375 70-71 21.8625 27.6 28.000000000000004 22.537499999999998 72-73 21.587500000000002 28.0875 27.6625 22.662499999999998 74-75 21.912499999999998 28.575 27.8375 21.675 76-77 22.662499999999998 27.474999999999998 27.987499999999997 21.875 78-79 22.3625 27.900000000000002 28.012500000000003 21.725 80-81 21.85 27.6375 27.175 23.3375 82-83 22.0125 28.3375 27.462500000000002 22.1875 84-85 21.875 27.800000000000004 27.487499999999997 22.8375 86-87 22.9875 28.1875 26.3625 22.4625 88-89 22.75 28.325 27.487499999999997 21.4375 90-91 22.7 27.925 27.175 22.2 92-93 22.037499999999998 27.825 27.55 22.5875 94-95 22.5625 27.5625 27.3625 22.5125 96-97 21.65 28.012500000000003 28.025 22.3125 98-99 22.975 27.675 26.637499999999996 22.7125 100 22.075 27.025 29.375 21.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 4.5 28 6.5 29 6.5 30 9.5 31 15.0 32 23.0 33 29.5 34 40.0 35 57.5 36 87.5 37 109.5 38 132.5 39 163.0 40 195.0 41 229.0 42 240.0 43 261.0 44 296.0 45 276.0 46 264.0 47 272.5 48 235.0 49 197.5 50 169.5 51 131.0 52 100.5 53 92.5 54 78.5 55 57.5 56 43.0 57 33.0 58 22.5 59 17.0 60 16.0 61 14.0 62 10.0 63 7.5 64 7.0 65 7.5 66 7.0 67 4.0 68 2.5 69 2.0 70 2.5 71 1.5 72 0.0 73 1.0 74 3.0 75 4.0 76 3.5 77 2.0 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0375 30-31 0.1625 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.3015075376884422 0.6 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02512562814070352 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.1375 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774407 spots for SRR3207995.sra Written 774407 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra Read 774391 spots for SRR3207995.sra Written 774391 spots for SRR3207995.sra SRR ids: ['SRR3207995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ct9k_21y SRR3207995.sra spots: 15487836 blocks: [[1, 774391], [774392, 1548782], [1548783, 2323173], [2323174, 3097564], [3097565, 3871955], [3871956, 4646346], [4646347, 5420737], [5420738, 6195128], [6195129, 6969519], [6969520, 7743910], [7743911, 8518301], [8518302, 9292692], [9292693, 10067083], [10067084, 10841474], [10841475, 11615865], [11615866, 12390256], [12390257, 13164647], [13164648, 13939038], [13939039, 14713429], [14713430, 15487836]] SRR3207995 file size 4019859 SRR3207995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207995 SRR3207995_1.fastq Input file: SRR3207995_1.fastq trimmed: SRR3207995-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 23:30:57 2025 >> started Tue Feb 11 23:31:04 2025 >> done (6.734s) 15487836 reads processed; of these: 3170 ( 0.02%) short reads filtered out after trimming by size control 62232 ( 0.40%) empty reads filtered out after trimming by size control 15422434 (99.58%) reads available; of these: 718460 ( 4.66%) trimmed reads available after processing 14703974 (95.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 371 0.00% 19 428 0.00% 20 525 0.00% 21 590 0.00% 22 875 0.01% 23 1260 0.01% 24 1752 0.01% 25 2064 0.01% 26 2532 0.02% 27 2277 0.01% 28 2153 0.01% 29 2304 0.01% 30 2215 0.01% 31 2342 0.02% 32 2478 0.02% 33 2329 0.02% 34 2529 0.02% 35 2563 0.02% 36 2664 0.02% 37 2757 0.02% 38 2913 0.02% 39 3007 0.02% 40 3213 0.02% 41 3236 0.02% 42 3514 0.02% 43 3642 0.02% 44 3577 0.02% 45 3661 0.02% 46 3718 0.02% 47 3829 0.02% 48 3775 0.02% 49 3905 0.03% 50 3872 0.03% 51 4020 0.03% 52 4162 0.03% 53 4325 0.03% 54 4382 0.03% 55 4459 0.03% 56 4730 0.03% 57 4863 0.03% 58 4858 0.03% 59 4972 0.03% 60 5221 0.03% 61 5364 0.03% 62 5631 0.04% 63 5595 0.04% 64 5986 0.04% 65 7300 0.05% 66 6239 0.04% 67 6432 0.04% 68 6671 0.04% 69 6715 0.04% 70 7476 0.05% 71 8185 0.05% 72 8045 0.05% 73 8068 0.05% 74 8025 0.05% 75 8446 0.05% 76 5662 0.04% 77 6397 0.04% 78 7505 0.05% 79 7929 0.05% 80 8424 0.05% 81 9117 0.06% 82 9948 0.06% 83 10484 0.07% 84 11023 0.07% 85 11617 0.08% 86 12211 0.08% 87 13223 0.09% 88 14301 0.09% 89 16064 0.10% 90 17296 0.11% 91 19129 0.12% 92 22153 0.14% 93 24887 0.16% 94 28846 0.19% 95 33590 0.22% 96 39772 0.26% 97 47677 0.31% 98 52535 0.34% 99 55630 0.36% 100 14703974 95.34% 15422434 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=8.73 fanout-score-rank=11 prefix-density=0.05 prefix-fanout=8.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=255.40 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.4 sequence=TTCTTCTTCTTC Started job on | Feb 11 23:31:21 Started mapping on | Feb 11 23:31:22 Finished on | Feb 11 23:31:38 Mapping speed, Million of reads per hour | 3470.05 Number of input reads | 15422434 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14322985 Uniquely mapped reads % | 92.87% Average mapped length | 99.02 Number of splices: Total | 4459246 Number of splices: Annotated (sjdb) | 4376248 Number of splices: GT/AG | 4389232 Number of splices: GC/AG | 59664 Number of splices: AT/AC | 4188 Number of splices: Non-canonical | 6162 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382915 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 564539 % of reads mapped to too many loci | 3.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 716534 716534 716534 N_multimapping 382915 382915 382915 N_noFeature 575472 7352836 7458286 N_ambiguous 138037 25336 25623 UnstrandedReadsAssigned:13609476 PositiveStrandReadsAssigned:6944813 NegativeStrandReadsAssigned:6839076 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207995 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207995-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,422,434 reads, 14,371,581 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52401 SRR3207995.ke.tsv 34699 SRR3207995.se.tsv 87100 total ==> SRR3207995.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 740 37.9412 Potri.005G024800.1.v4.1 1035 936 265 27.8563 Potri.004G059700.1.v4.1 961 862 11 1.25557 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 292.381 10.1152 Potri.016G087400.1.v4.1 270 171 353 203.111 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 92 5.40737 Potri.012G127500.1.v4.1 977 878 3973 445.223 ==> SRR3207995.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 962 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR3207995 completed mapping pipeline successfully